Biology 1202B Lecture Notes - Lecture 12: Dna Polymerase, Dna Replication, Dna Clamp

88 views5 pages

blushsea-lion259

24 Apr 2013

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Dispersive neither parental molecule remains in tact; both chains of each replicated double helix contain old and new segments. 1958 meselson and stahl: bacteria was grown for several generations in an n15 (heavy) medium. The heavy isotope, n15 has one more neutron in its nucleus than the normal. N14 isotope: the heavy isotope was incorporated into the nitrogenous bases of dna, resulting in the entire dna being labeled with n15, after transferring the bacteria into a medium containing light n14 isotopes, the new. Dna polymerase is the primary enzymes of dna replication. Dna of different densities separated into bands, with the densest dna settling closer to the bottom of the tube. During replication, complimentary polynucleotides chains are assembled from individual deoxyribonucleotides by enzymes known as dna polymerase. Deoxyribonucleoside triphosphates are the substrates for the polymerization reaction catalyzed by. Dna polymerase catalyzes the assembly of a new dna strand that is complimentary to the template strand.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

Biology 1202B Lecture Notes - Lecture 12: Dna Polymerase, Dna Replication, Dna Clamp

Document Summary

Get access

Related Documents

Biology 1202B Lecture Notes - Lecture 12: Dna Replication, Helicase, Dna Ligase

Biology 1202B Chapter Notes - Chapter 11: Isotopes Of Nitrogen, Semiconservative Replication, Escherichia Coli

Biology 1202B Chapter Notes - Chapter 12: Xeroderma Pigmentosum, Proofreading, Mitosis

Related Questions