1
answer
0
watching
152
views
pinkserval13Lv1
28 Sep 2019
1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold âGâ.
a) Underline the promoter region of this gene by a dotted line.
b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?
c) Deduce the nucleotide sequence of mRNA for this gene.
d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino
acids does this mRNA code for? What is the sequence of the codons in this mRNA?
e) Show 5â and 3â ends of the template strand and mRNA.
f) What are the -10 and +10 base pairs of this gene?
CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold âGâ.
a) Underline the promoter region of this gene by a dotted line.
b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?
c) Deduce the nucleotide sequence of mRNA for this gene.
d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino
acids does this mRNA code for? What is the sequence of the codons in this mRNA?
e) Show 5â and 3â ends of the template strand and mRNA.
f) What are the -10 and +10 base pairs of this gene?
CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
Jamar FerryLv2
28 Sep 2019