1
answer
0
watching
152
views

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

For unlimited access to Homework Help, a Homework+ subscription is required.

Jamar Ferry
Jamar FerryLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in

Related textbook solutions

Related questions

Weekly leaderboard

Start filling in the gaps now
Log in