2
answers
0
watching
23
views
10 Nov 2019
During translation, the m * all of the Okazaki fragments together, ensuring that all nucleotides are bound to their neighbors. . After the end of DNA replication, an enzyme called used to produce this po are com The mRNA is "read" in g These are read in the 5 . What is the complimentary strand to 3' AATGCCCATTTCGCGG 5 Translation has three phases: What is the complimentary strand to 3' TTTCCGGAATTCCCGGG 5 . begins when mRNA attaches t sequence has no AUG codon RNA During transcription, RNA is transcribed or copied from a small segment of DNA containing a single gene or part of a single gene. The DNA strand that the RNA is transcribed from, is the template strand. The non-template strand that is not being copied is referred to as the coding strand. There are three phases in RNA transcription: initiation, elongation, and termination ribosome, tRNA will provide t mRNA. For AUG, the tRNA se Each tRNA anti-codon, brings determines which amino aci Methionine or MET for shor longer and longer. The term stop codons: UAA, UAG, or During the initiation phase, the promotor region indicates the start of transcription. The RNA strand will be transcribed from a todirection. During the elongation phase, the will continue to add RNA nucleotides to the growing stand. will attach to the promotor region. The A mRNA sequence If the DNA strand reads 3' AGGTTAC 5', the transcribed RNA strand will be 5 Using Figure 14.5 of your During the termination phase,the RNA polymerase encounters the terminator region of wikipedia DNA that indicates the end of transcription The type of RNA that is produced during transcription is following sequence of mi looking at the chart, you e What is the RNA strand to a DNA template strand 3' AATGCCCATTTCGCGG 5 What is the RNA strand to the following DNA template strand? 3' TACTTGCATGAATTTCGCGGATATGGGCCCACT 5 . 68
During translation, the m * all of the Okazaki fragments together, ensuring that all nucleotides are bound to their neighbors. . After the end of DNA replication, an enzyme called used to produce this po are com The mRNA is "read" in g These are read in the 5 . What is the complimentary strand to 3' AATGCCCATTTCGCGG 5 Translation has three phases: What is the complimentary strand to 3' TTTCCGGAATTCCCGGG 5 . begins when mRNA attaches t sequence has no AUG codon RNA During transcription, RNA is transcribed or copied from a small segment of DNA containing a single gene or part of a single gene. The DNA strand that the RNA is transcribed from, is the template strand. The non-template strand that is not being copied is referred to as the coding strand. There are three phases in RNA transcription: initiation, elongation, and termination ribosome, tRNA will provide t mRNA. For AUG, the tRNA se Each tRNA anti-codon, brings determines which amino aci Methionine or MET for shor longer and longer. The term stop codons: UAA, UAG, or During the initiation phase, the promotor region indicates the start of transcription. The RNA strand will be transcribed from a todirection. During the elongation phase, the will continue to add RNA nucleotides to the growing stand. will attach to the promotor region. The A mRNA sequence If the DNA strand reads 3' AGGTTAC 5', the transcribed RNA strand will be 5 Using Figure 14.5 of your During the termination phase,the RNA polymerase encounters the terminator region of wikipedia DNA that indicates the end of transcription The type of RNA that is produced during transcription is following sequence of mi looking at the chart, you e What is the RNA strand to a DNA template strand 3' AATGCCCATTTCGCGG 5 What is the RNA strand to the following DNA template strand? 3' TACTTGCATGAATTTCGCGGATATGGGCCCACT 5 . 68
shakadigLv1
6 Jul 2023
Unlock all answers
Get 1 free homework help answer.
Already have an account? Log in
Casey DurganLv2
27 May 2019
Get unlimited access
Already have an account? Log in