CHEM 6A- Final Exam Guide - Comprehensive Notes for the exam ( 59 pages long!)

Stadent An Introduction to the Chemical Basis of Life Thiere ave ninety-two naturally occurring elements in the universe. An element is a substance that canniot he separated into simpler substances by purely chemical means The smallest indivisible unit of an element is the atom is composed of three fundamental particles, protons s and electrons Protons are positively charged particles and along with neutrons, which not have any electrical change and are therefore n neutron cutral. are found in the nucleus of the atom Electrons are negatively charged particles that occupy specific orbits around the nucleus t with cach to form discrete units called molecules The atoms of a molecule can te kind or different kinds; that is, they can be the same or different clements be the sa Molecules containing atoms of two or more known as compounds different elements in specific proportions are Objective: Review and practice chemical concepts introduced in your lecture Using your lecture notes, textbook and the periodic table provided 1. Worksheet: identify in one or two sentences the following concepts related to the periodic table: Family or Group · Period Mctal Transition Element Non-metal . Inert gases Valencoe Electronegativity

CHEM 151 Fall 2016 Final Exam Review Chapter 8, Chapter 9.1 1. Explain why, RNA, and not DNA, is hydrolyzed under basic pH conditions. Draw a mechanism to explain your reasoning. 2. A strand of DNA has the following sequence: S TCGTTTACGATCCCCATTTCGTACTCGA 3 a) What is the sequence of its complementary strand? b) What is the base sequence of mRNA transcribed from the first strand? 3. Hand-draw out the DNA sequence AGTC and its complement including sugars and phosphate backbone. Show the hydrogen-bonding between the base pairs and label the directionality of each strand 4. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoRI SATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 5. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme BamHI S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3" 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 6. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme Kpnl and Hind III S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 7. Describe why a double-stranded DNA with a high G-C content has a higher Tm than a double-stranded DNA with a high A-T content. 8. A Sanger dideoxy sequence analysis was performed on wild type and a mutant gene. The sequencing gels are represented below. From these results