BIOL 1001 Chapter : CH 9 Student Outline

6 views22 pages

azuremammoth471

15 Mar 2019

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

What is the structure of the genome: chromosome and dna structure. How is the genome copied: dna replication. What is the genome used for: protein synthesis. Nitrogenous bases: purines (a=adenine g=guanine) (double ring, pyrimidines (t=thymine c=cytosine) (single ring, all species amount of a=t and g=c but each species has its own ratio of at/gc. Model of how nucleotides combine to form a polymer. Chromosome structure: eukaryotic chromosome structure, dna (linear molecule, histone proteins, dna replication involves making dna from dna (clicker, dna replication occurs in a semi-conservative mechanism (clicker, ultimately the information in dna is used to make proteins. Dna structure: four nucleotides, complementary base pairing (hydrogen bonds) (a-t & c-g, double helix, anti-parallel backbones. How is dna copied: how do you make exact copies, what does the structure of dna tell you about how to copy it, replication, semi-conservative- where replication occurs, have one original backbone (conservative part) *must travel from 3" to 5" or 5" to 3".

Related Questions

QUESTION 1. Compared to eukaryotic genomes, only prokaryotic genomes:

A. contain DNA organized by histones.

B. contain usually one, circular chromosome.

C. contain plasmid DNA.

D. have chromosomes contained in a nucleus.

QUESTION 2. Azathioprine is a drug that may be prescribed to transplant recipients to reduce the chance of tissue rejection reactions. In its active state, it acts as a purine analogue, inhibiting DNA biosynthesis. This means that 6-mercaptopurine will be inserted in place of a purine containing nucleotides during DNA replication. Given this drug's mode of action, you would expect it to be incorporated into DNA in place of:

A. nucleotides containing guanine or cytosine.

B. nucleotides containing adenine or thymine.

C nucleotides containing adenine or guanine.

D. nucleotides containing guanine nucleotide or uracil.

QUESTION 3. RNA is distinguished from DNA because only RNA:

A. typically exists as a single-stranded molecule.

B. has a 3' to 5' directionality.

C. is composed of nucleotides that contain the sugar deoxyribose.

D. is composed of nucleotides that contain the nitrogen bases T, C, G, and A.

QUESTION 4. How are RNA nucleotides different from DNA nucleotides? To be marked correct, you'll need to select all true statements, as there may be more than one correct answer.

A. RNA nucleotides do not contain thymine.

B. RNA nucleotides use the sugar ribose, while DNA nucleotides do not.

C. RNA nucleotides lack phosphate.

D. RNA nucleotides incorporate pyrimidine nitrogen bases, while DNA nucleotides only incorporate purine nitrogen bases.

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

Please provide correct answer and explanation to the answer,Thank you!

If an enterprising graduate student decided to repeat theHershey-Chase

experiment but neglected to perform the blending portion, wherewill the

isotopes be found?

a. 35S will be found in the supernatant and 32P will be found inthe pellet

b. 32P will be found in the supernatant and 35S will be found inthe pellet

c. Both 32P and 35S will be found in the supernatant

d. Both 32P and 35S will be found in the pellet

e. None of the above are correct
Chargaffï¿½s rules include:

a. The ratio of Aï¿½s + Tï¿½s to Gï¿½s + Cï¿½s is always consistent

b. A=G and T=C

c. Purines/Pyrimidines = 1

d. More than one of the above are true

e. None of the above are true
Sea Urchin DNA contains 18% guanine (which is true); how muchthymine

does it contain?

a. 9%

b. 18%

c. 32%

d. 36%

e. 64%
E. coli DNA contains a little over 25% guanine. If samples weretaken of E.

coli DNA and Sea Urchin DNA and denatured in water baths, whichwould

melt at a lower temperature?

a. E. coli DNA

b. Sea Urchin DNA

c. They would melt at the same temperature

d. There is not enough information to determine the answer

e. DNA doesnï¿½t ï¿½melt,ï¿½ it isnï¿½t ice cream for goodness sake!
If testing the second generation results in tube B, which modelcan we

conclude is correct?

a. Dispersive

b. Semi-conservative

c. Conservative

d. Semi-dispersive

e. We canï¿½t conclude yet, it could still be more than onepossibility
Phosphorus is required to synthesize dNTPs used in DNAreplication. Imagine

you grow E. coli in media containing non-radioactive phosphorusfor many

generations, then switch the E. coli to media containingradioactive

phosphorous (32P). You then sample the E. coli after one roundof replication

for radioactivity. Where will you find radioactive phosphorus inthe DNA?

a. Both strands will contain 32P

b. One strand will contain 32P

c. Neither strand will contain 32P

d. Drats! I knew I should have done suggested problem 12.19!
Which of the following statements about chromosomes are alwaystrue?

I. Non-histone proteins make up about 5% of a eukaryotic

chromosome by weight

II. Histones have a negative charge

III. Prokaryotes have a single linear chromosome

a. Only Statement I is true

b. Only Statement II is true

c. Only Statement III is true

d. More than one of the above statements are true

e. None of the above statements are true
What portion of the human genome is made up of highly repetitiveDNA?

a. Less than 5%

b. 6 ï¿½ 20%

c. 21 ï¿½ 30%

d. 31 ï¿½ 40%

e. Over 40%
Which of the following statements are always true?

I. Histones are very conserved between species

II. Archaea have nuclei

III. Prokaryotes are haploid and eukaryotes are diploid

a. Only Statement I is true

b. Only Statement II is true

c. Only Statement III is true

d. More than one of the above statements are true

e. None of the above statements are true
An individualï¿½s phenotype is a function of:

a. The alleles they carry

b. The environment they live in

c. The interaction between an individuals genes and theenvironment

d. Two of the above are correct

e. All of the above are correct
A homologous pair of chromosomes showing a

crossover are shown to the right for reference. Are all

the sperm from one human male genetically identical?

a. Yes

b. No, variation occurs during mitosis

c. No, variation occurs during meiosis I

d. No, variation occurs during meiosis II

e. No, variation occurs during both meiosis I and II
Production of gametes in humans requires which kind ofdivision?

a. Meiotic and is reductional

b. Mitotic and is reductional

c. Meiotic and is equational

d. Mitotic and is equational

e. None of the above

scarletmallard658

BIOL 1001 Chapter : CH 9 Student Outline

Document Summary

Get access

Related Documents

BIOL 1001 : Bio 1001 Notebook Final

BIOL 1001 Chapter : Chapter 11 Notes

BIOL 1001 Lecture : BIO 1001 Final Notes 1

Related Questions