BIOL 150 Chapter Notes - Chapter 4: Hydrophile, Uracil, Rna World

27 views2 pages

blushcrocodile584

15 Oct 2016

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Adenosine triphosphate (atp) - the most important biological molecule that supplies energy to the cell; made of three phosphates which raises the potential energy of substrate molecules enough to make an otherwise non spontaneous reaction possible. Antiparallel - dna side by side and running in opposite directions (meaning 5" to 3" while the other strand ran 3" to 5") Complementary base pairing - hydrogen bonding between particular pyrimidines and purines; Adenine and thymine (two hydrogen bonds); cytosine and guanine (three hydrogen bonds) Deoxyribonucleic acid - dna; usually a double stranded helix, in which each polynucleotide strand consists of nucleotide monomers with a deoxyribose sugar and the nitrogenous bases a. T c g; capable of being replicated and determining the inherited structure of cell"s proteins. Deoxyribonucleotides - are building blocks of dna; sugar is deoxyribose and has an -h bonded to the 2" carbon and an -oh group bonded to the 3" carbon.

Related Questions

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

skyhamster121

1. Which of the following is the correct sequence of events (from start to finish) in cellular fatty acid oxidation?

A. Fatty acid activationÃ carnitine shuttleÃ beta-oxidation

B. Beta-oxidationÃ carnitine shuttleÃ Fatty acid activation

C. Fatty acid activationÃ carnitine shuttleÃ beta-oxidation

D. Carnitine shuttleÃ Fatty acid activationÃ beta-oxidation

2. What reaction is catalyzed by lipoprotein lipase, or lipase?

A. Hydrolysis of TAGs into fatty acids and glycerol

B. Hydrolysis of TAGs into amino acids and glycerol

C. Hydrolysis of cholesterol in to fatty acid and water

D. Hydrolysis of cholesterol into acetyl-CoA

3. How do fatty acids of different carbon lengths cross into the mitochondrial matrix for oxidation?

A. Small FAs of 10 carbons or fewer can freely diffuse through the membrane

B. Large FAs are cleaved into two smaller units that are actively transported across the membrane

C. A membrane-bound transferase catalyzes the conversion of long-chain FAs and FA-carnitine esters, which are transported across the membrane via a specific carrier

D. The breakdown of large FAs starts outside the matrix, allowing for the smaller particles to pass easily through the membrane

4. How can any RNA nucleotide be easily distinguished from a DNA nucleotide?

A. RNA nucleotides have a unique phosphodiester bond linkage

B. RNA nucleotides have uracil nitrogenous bases

C. RNA nucleotides have an -OH on the 2â carbon of the ribose

D. RNA nucleotides cannot be easily distinguished from DNA nucleotides

5. Which of the following statement is true concerning the sequence pTACGTAACGTA?

A. This is an RNA sequence

B. In order to have a more rigid structure in a double-stranded molecule, the sequence given would need more adenosine

C. If the complementary strand were present, the number of purines would be equal to the number of pyrimidines

D. The amount of purines is equal to the amount to pyrimidines

6. Complementary base pairing is considered which level of structure?

A. Secondary

B. Tertiary

C. Quaternary

D. Primary

7. Which of the following is/are required for the polymerization reaction catalyzed by DNA polymerase III?

I. RNA primer

II. DNA primer

III. RNA template

IV. DNA template

V. NTPs

VI. dNTPs

VII. Magnesium

VIII. Calcium

A. II, IV, V, and VII

B. II, IV, VI, and VII

C. I, IV, V, and VIII

D. I, IV, VI, and VII

8. DNA polymerase I, from E. coli, has three different catalytic sites. Which of the following is NOT one of them?

A. RNA-dependent RNA polymerase

B. RNA-dependent DNA polymerase

C. DNA-dependent RNA polymerase

D. DNA-dependent DNA polymerase

9. Eukaryotes solve the problem of replicating the ends of their linear chromosomes by:

A. Using a protein as primer

B. Enzyme activity that uses an RNA template and reverse transcription in a series of repeat cycles

C. All of the listed solution

D. Terminal redundancy whereby each end of the chromosome is duplicated allowing recombination

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 150 Chapter Notes - Chapter 4: Hydrophile, Uracil, Rna World

Document Summary

Get access

Related Documents

BIOL 150 Chapter Notes - Chapter 15: Xeroderma Pigmentosum, Proofreading, Chromosome

BIOL 150 Study Guide - Final Guide: Cytosine, Phosphodiester Bond, Uracil

BIOLOGY 1A03 Chapter Notes - Chapter 4: Genetic Code, Ovarian Cancer, Semiconservative Replication

Related Questions