Lecture 14.doc

12 Pages
82 Views
Unlock Document

Department
Microbiology (Biological Sciences)
Course
MICRB316
Professor
Nicolas Vozza
Semester
Winter

Description
Lecture 14 1 REGULATORY NETWORKS Reg. Networks are interlinked control systems; some are complex) Not just 1 or 2 regulators affecting a single gene or operon, but many transcripts. Should NOT be understood as independent control circuits, but rather a global network, affecting many different genes - often unrelated genes Thefollowingexamplesillustratethatalmostnothinghappensin a celllwithoutaffectingtheothercellular activitiesandreactions. Definitions – steps of increasing complexity Operons > Regulons > Modulons/Stimulons Operon – a number of genes (often related in function) encoded as a transcriptional unit AND transcriptionally co-regulated. Typical of prokaryotes (polycistronic arrangement) e.g. metabolic pathways (galETK, araBAD, lacZYA) Regulon – organization of several independent operons, controlled in a coordinated way. All share a common regulatory protein. Does not mean genes are always expressed in a parallel manner (1. extent of reg varies AND 2. activation of one operon/gene can be concurrent with repression of others by same regulator. e.g. heat shock; SOS; Lrp) Lecture 14 2 Modulon – describes independent operons that belong to different regulons but respond to a common regulator. A regulatory level above a regulon. More global reg units. e.g. metabolic genes encoding catabolic enzymes regulated by CRP-cAMP. Regulated by regulator. Stimulon – describes a collection of genes that respond to a common stimulus independent of their regulatory organization. Related by operation. e.g. Heat Shock causes σH regulon induction. Lots of other unrelated genes NOT under control of this σ factor will be up- or down-regulated (activated or repressed), all by different types of regulators but all responding to the same stimulus. Can be studied using chip-on-chip. Chip has all the transcripts of a certain bacteria. Probe with RNA extract of your bacteria (same species as chip is for) under certain conditions and see which genes are being activated. Can chop up DNA, immunoprobe for your regulator. Take the regulator + DNA regulator is bound to. Can then remove protein and probe DNA on chip to see which genes the regulator is controlling. SOS Response: a regulon under control of LexA. Radman ‘74 One of the first clear networks of Tn regulation identified in bacteria. Lecture 14 3 Straightforward logic; sophisticated circuitry; helps the cell finely tune response. Lecture 14 4 Comprises a set of coordinated physiological responses induced by DNA damage. It induces > 20 different genes involved in different mechanisms of DNA repair. 1. mismatch 2. recombinational 3. excision / error-prone SOS expression involves 2 proteins, LexA and RecA I. LexA – a typical Tn repressor – MW = 22.7 kDa Each protein has 2 domains connected by a flexible hinge. A. N terminal domain = AAs 1-84 = DNA-binding region different but structurally related to a HTH. B. C terminal domain = dimerization domain. Proteins link together at C terminus to form a dimer. A palindromic operator sequence (termed the SOS box) is recognized by the dimeric repressor. TACTGTATATATATACACTA SOS box operons are found upstream of all genes in the SOS regulon. Sometimes more than one operator can be found there (N=1-3) Operator positions relative to the promoters are variable: e.g. uvrA – SOS box overlaps –35 hexamer Lecture 14 5 - uvrB or recA – SOS box located between –35 & -10 - sulA – overlaps –10 - uvrD – downstream of –10 promoter sequence 1. Different operator positions may indicate genes are not regulated to the same extent. 2. Differences in SOS box sequences  different affinities for LexA dimer. Both of these lead to fine tuning the regulation Most SOS regulated genes are expressed at a low basal level in the uninduced cell, including RecA. II. RecA. 37.8 kDa. Multifunctional protein in cell (also important in homologous recombination) For SOS, RecA mediates the induction of genes coordinately repressed by LexA. Lecture 14 6 In other words, LexA repression is relieved by proteolytic cleavage of the LexA repressor proteins. BUT, RecA is not a classical protease. Instead it facilitates a latent capacity of LexA to AUTODIGEST  LexA cleavage leading to 2 fragments of similar size. In the absence of DNA damage, LexA is perfectly stable; even though normally there are 7000 copies of RecA / cell When RecA senses DNA damage as a signal (& this is most probably ssDNA regions resulting from various forms of DNA damage), RecA stimulates LexA cleavage. RecA is activated by single stranded DNA. The RecA/ssDNA nucleoprotein filament is generated when cell initially attempts to replicate damaged DNA. RecA binding ssDNA results in activated RecA designated RecA*. To mediate LexA cleavage, RecA* requires ATP, though ATP hydrolysis to ADP is not requires for cleavage of LexA by LexA. (binding of RecA to DNA???) Activation of RecA is reversible & prevails as long as inducing signal (ssDNA) is abund
More Less

Related notes for MICRB316

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit