MBG 2400 Lecture Notes - Lecture 13: Cavendish Banana, Harriet Creighton, Sister Chromatids

57 views5 pages

sangriapig868

12 Jan 2017

School

University of Guelph

Department

Molecular Biology and Genetics

Course

MBG 2400

Professor

Elizabeth Lee

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Reduction: homologous chromosome separate in meiosis 1. Division: sister chromatids separate in meiosis 2. Remember that independent assortment allows equal chances for different types of gametes. Contain all mendelian genes, but not all dna and genetic code. Can be used to identify specific chromosomes. Allow combinations to occur between linked genes. End up with 4 genetically unique spores. X - basic number of chromosome in a species. Don"t need to worry about x and n for the midterm. Like bananas, triploid or tetraploid or diploid. Each chromosome is present in two copies. Recombination exchange of material between sister chromatids. Harriet creighton and barbara mcclintock first demonstrated the physical. One crossover per chromosome arm per generation. Shuffles the genes of the 2 parents. Can cause by radiation, chemicals, or spontaneous. Particulate (alpha, beta particles, neutrons, cosmic rays) Mustard gas and malic hydrazide(attacks heterochromatic(condensed) region) The fg fragment is called an acentric fragment.

Related Questions

1). Explain the significance of the fact that gametes contain half of the chromosome complement of somatic cells. Tell me something about variation, if you have a sibling (if you don't imagine you do) - how is your sibling's genetic make-up similar and/or different from yours? What about your mom and dad?

2). Explain the terms reductional division and equational division. What is reduced or kept equal? To which nuclear divisions do these terms refer?

3). What is the diploid number (2n = ?) of an organism if it has
a) 12 chromosomes at Anaphase of Mitosis?
b) 12 chromosomes at Anaphase I of Meiosis?
c) 12 chromosomes at Anaphase II of Meiosis?

4). Compare/contrast Metaphase I of Meiosis with Metaphase of Mitosis.

5). What are the two mechanisms of variation in Meiosis, and during which stage(s) does each occur?

6). Draw a diagram of a bivalent and label the following parts: centromere, sister chromatids, non-sister chromatids, homologous chromosomes, chiasma.

7). A diploid cell has 1 pair of acrocentric chromosomes (Chromosome 1) and 1 pair of submetacentric chromosomes (Chromosome 2).
Â· Gene X is on Chromosome 1. Gene Y is on the short arm of Chromosome 2 and Gene Z is on the long arm of Chromosome 2.
Â· The maternal chromosomes have the X, y, z alleles, whereas the paternal chromosomes have the x, Y, Z alleles.
Draw these chromosomes, labeling ALL alleles, as they might appear in Metaphase I of Meiosis.

PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT.

3'- GGCCTTAAGCATGCATGCAT -5'

5'- CCGGAATTC(G)TACGTACGTA -3'

1. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?

a) not enough information is provided

b) top strand

2. Which of the following occurs during Metaphase I of meiotic cell division?

a) Tetrads composed of homologous chromosomes line up at the center of the cell

b) homologous chromosomes separate

c) sister chromatid pairs line up at the center of the cell

d) non-sister chromatids exchange regions of DNA

3. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?

a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids

b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid

c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid

4. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.

I. DNA pol I synthesizes DNA

II. DNA ligase seals the nicks in the daughter DNA

III. DNA pol I removes the RNA primers

IV. DNA pol III synthesizes DNA

a) IV-III-I-II

b)I-III-IV-II

c) III-I-II-IV

5. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?

a) 0%

v) 100%

c) 25%

6. For oxytocin signaling between two neurons, what is the correct order of events?

I. an oxytocin vessicle fuses with the plasma membrane

II. an oxytocin vessicle docks with plasma membrane

III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron

IV. oxytocin molecules diffuse into the synapse

a) I-III-II-IV

b) II-I-IV-III

c) I-II-III-IV

7. The independent assortment of chromosomes is due to events that occur during ______.

a) meiosis I only

b) meiosis II only

c) mitosis and meiosis II

champagnemole592

What is a genome? What is a genome made of? Describe the bacterial genome. How do bacteria reproduce? What is binary fission? Distinguish between a chromosome and chromatin. Where are chromosomes located in eukaryotic cells? What is the chromosome made of? What is a centromere? What is the centromere's role? What are sister chromatids and how do they arise? Distinguish between somatic cells and germ (gametes) cells. Describe the cell cycle. What are the different phases? What occurs during S phase? What is interphase? How is the cell cycle controlled?

Describe mitosis. What are the phases of mitosis? What occurs in each of the phases of mitosis? What is cytokinesis? How does this differ between plant and animal cells? What is a kinetochore? Where does it form? What is its role? What is the role of microtubules in mitosis? What is a centriole and what is it composed of? What is a centrosome and what is its role in mitosis? What is the metaphase plate and why is this important? What is the mitotic spindle, its role and its makeup? What defines a diploid cell? How many copies of each chromosome is in a diploid cell? What about a haploid cell? Why do the daughter cells of mitosis always have the same complement of chromosomes?

Describe meiosis. What are the phases of meiosis? What occurs in each of the phases of meiosis? Distinguish between meiosis I and meiosis II and describe how each of these processes compare to mitosis. Why do animal cells undergo meiosis? What is a gamete? What is a zygote? What are recombination, crossing-over, and chiasma? When and why does this occur? What is meant by 'homologous pair of chromosomes'? Why don't the daughter cells of meiosis have the same genetic makeup? What controls the segregation of chromosomes into the gametes?

What are genetic characters? What are genetic traits? What is an allele? What is a locus? How many alleles at each locus would a human cell have and why? Distinguish between genotype and phenotype. What is meant by a dominant gene? What is meant by a recessive gene? How do these differ? What is the genotype of a homozygous dominant organism? What is its phenotype? What is the genotype of a homozygous recessive organism? What is its phenotype? What is the genotype of a heterozygous organism? What is its phenotype? What is a genetic cross? Distinguish between the P, F1, and F2 generations. What is a true-breeding line? What is the genotype and phenotype of a cross between homozygous dominant and homozygous recessive parents? If the F1 progeny are crossed, what would be the genotype and phenotype of the F2 generation? What would be the phenotypic ratio? What would be the genotypic ratio? Be ready to generate Punnet square tests or probability analyses of crosses involving more than one genetic locus. Describe a dihybrid cross where two alleles are homozygous dominant in one parent and homozygous recessive in the other. What would be the phenotypic ratio of the F2 generation from this dihybrid cross? What is meant by independent assortment? Be prepared to calculate probabilities resulting from different crosses.

Distinguish between complete and incomplete dominance. How would incomplete dominance alter the results of a hybrid cross? What would the resulting F2 generation phenotype and genotype ratios be? What is codominance? How does this affect the results of crosses? Be prepared to determine likely blood types of parents based on the blood types of their offspring. What is a polygenic trait? What is a carrier state for a genetic disease? What is meant by linked genes? How does this affect expected outcomes of genetic crosses? How is gene linkage used for chromosomal mapping? Distinguish between autosomes and sex chromosomes. What sex chromosomes are found in women? What sex chromosomes are found in men? What are sex-linked traits? Be prepared to give the results of crosses that involve sex-linked recessive traits. What is the process of nondisjunction? What are the likely results? Why is this important? What is a Barr body? Recognize the genetic abnormality of Downs Syndrome, Turner's Syndrome, and Klinefelter's Syndrome.

pucewallaby221

MBG 2400 Lecture Notes - Lecture 13: Cavendish Banana, Harriet Creighton, Sister Chromatids

Document Summary

Get access

Related Documents

MBG 2400 Lecture Notes - Lecture 14: Sister Chromatids, Seedless Fruit, Musa Balbisiana

MBG 2400 Study Guide - Midterm Guide: Paramutation, Epigenetics, Phenotype

MBG 2400 Lecture Notes - Lecture 6: Sister Chromatids, Dihybrid Cross, Mendelian Inheritance

Related Questions