BIOL 112 Lecture 22: Positive and Negative Regulation APOG The Boo Operator Genetic Analysis of the Lac Operon

74 views3 pages

cerisegiraffe538

12 Nov 2014

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

jakbfousda and 39238 others unlocked

BIOL 112 Full Course Notes

Verified Note

59 documents

Document Summary

Biol 112 - biology of the cell - chapter 19 (lecture 22): Genetic regulations are often studies in bacteria because prokaryotes are simplier to examine. In this chapter, the mechanisms escherichia coli uses to extract energy from lactose are studied to demonstrated positive and negative regulation. Positive regulation: a regulatory molecules binds to a site near the gene to initiate transcription. The regulatory molecule is called an activator. Sometimes the activator can bind to a small molecule. The small causes allosteric effect, meaning that it changes the conformation of the activator. The change in conformation can either help or prevent the activator from binding to dna. Negative regulation: a regulatory molecule binds to prevent transcription. The regulatory molecule is called an repressor. The repressor can bind to a small molecule called inducer. The inducer can help or prevent the repressor from binding.

Related Questions

1.) What type of control best describes the lac operon when it is regulated by allolactose? Explain the features of this type of regulation using the lac operon as an example.

2.) What is positive gene regulation?

a) when an activator protein binds to the operator of a gene to turn expression off

b) when a repressor protein binds to the operator of a gene to turn expression off

c) when an activator protein binds to the operator of a gene to turn expression on

d) when a repressor protein binds to the operator of a gene to turn expression on

e) when a protein binds to DNA to change gene expression

3.) In the lactose operon of E. coli, what is the function of each of the following genes or sites: a) regulator, b) operator, c) promoter, d) structural gene Z and e) structural gene Y?

a) regulator gene

b) operator

c) promoter

d) structural gene Z

e) structural gene Y

4.) In a negative, repressible regulatory mechanism, transcription of the structural gene(s) occurs in

a) the presence of the co-repressor, but not in its absence.

b) the absence of the co-repressor, but not in its presence.

c) the presence of the inducer, but not in its absence.

d) the absence of the inducer but not in its presence.

e) the absence or presence of the co-repressor.

What are answers and can you explain them to me?

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 112 Lecture 22: Positive and Negative Regulation APOG The Boo Operator Genetic Analysis of the Lac Operon

BIOL 112 Full Course Notes

Document Summary

Get access

Related Documents

BIOL 112 Chapter Notes - Chapter 4, 19: Lactose Permease, Lac Operon, Trp Operon

BIOL 112 Study Guide - Final Guide: Chromosome, Chromatin, Entertainment Uk

BIOL 112 Study Guide - Amine, Starch, Chemiosmosis

Related Questions