BIOC14H3 Lecture 7: BIOC14 lecture 7 Notes

Although the DNA in our genes is considered to be the heritablegenetic material, other factors, including the environment areconsidered to play an important role in the activity and expressionof those genes. Please summarize the role that epigenetics &developmental epigenetics play in health & disease.

What discoveries in genetics have led to the realization that genetic mapping is not quite as simple as genes being linked or not? List two in your answer and explain how they added layers to our current understanding of mapping and gene expression. An example is epigenetics, the field of genetics that tracks expression based on environmental factors. Someone might carry two closely associated ("linked") genes, but one's expression is modified by environmental factors, making interpretation of whether they (genes) behave according to Mendelian principles difficult. Provide two more examples and list why you think they have made studying gene linkage somewhat tricky.

Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells.

Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.

Finally - using the codon table found on page 402 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc