Class Notes (806,783)
Canada (492,447)
BIOB12H3 (30)
Lecture 4

Laboratory Exercise - Week 4.pdf

12 Pages
Unlock Document

University of Toronto Scarborough
Biological Sciences
Daman Bawa

Brunt 2011Molecular Biology Module Laboratory 4 Preparation of Competent cells Plasmid Transformation and plasmidDNA isolation Laboratory 5 Restriction enzyme analysis andagarose gel electrophoreses Laboratory 6 Agarose Gel Analysis and restriction MappingLaboratory 4 Preparation of Competent cells Plasmid transformation and Plasmid DNA isolationoutline 4APreparation of competent cells and plasmid transformation 4B plasmid DNA isolationObjectives over the three weeks of Laboratories in the Molecular Biology ModuleIntroduction to the basic techniquesand terminology used in molecular biologyWhat is a plasmid vectorThe role of plasmids in cloningHow tomanipulate Ecoli to take up extrachromosomal DNAHow to identify transformed Ecoli cellsCalculation of transformation efficienyThe role of restriction enzymes inDNA manipulationHow to set uprestriction endonuclease digestsUse of Agarose gel electrophoresisAnalysis of DNAseparated on Agarose gelsConstruction of restriction Mapsof DNA usingrestriction endonuclease digests o All of the above are the basic techniquesand knowledge that are absolutely essential to be able to carry out anyexperiment utilizing DNA The above concepts and techniquesare the foundation on which all other advanced techniques are builtBackground To understandmolecular cloning techniques or recombinant DNA techniques you mustbe familiar with the terms used You must also understand how to grow and manipulate the hosts used in these techniquesLast week you were introduced toEcoliand howmonitor growth of Ecoli the workhorse host of molecular biologyOnce your understand how to grow Ecoli youthen need to understand how you can manipulate the organism to easily take upmolecular biology vectors such as plasmids and bacteriophagesIt is the ability to insert foreign DNA into these vectors have Ecolitake up these vectors and make multiple copies of these vectors within the cellpropagation of individual DNAmolecules that is the essenceof molecular cloning 1Brunt 2011 Recombinant DNA technology is a array of techniques whichis continually advancing but all are based on the basic concepts of molecular cloningWe refer to this as cloningbecausea clone of host cellsgroup of identical cellsis generated which contains only one type of recombinant DNA moleculeTerminology1 Restriction enzymes Enzymeswhich are naturally produced by prokaryotesare commercially produced andrecognize specific DNA sequences and act as endonucleases to break the phosphodiester backbone of DNA at specific sitesThe type II restriction enzymes recognize palindromic sequencesPalindromes are regions of two fold symmetry and the nucleotide sequence is identical on both strands if read from the same directionFor example the double stranded DNA below contains the palindrome AAGCTT5 CCTGTCAGAATTGTAAGCTTCAATGGCGCATATCG33 GGACAGTCTTAACATTCGAAGTTACCGCGTATAGC52 Library A collection of clones representing either the entire genome of an organism or the genes which are expressed as mRNA see belowcDNA library the target DNA is generated by making a DNA copy ofmRNA from the organism or tissue or developmental stage ofinterestgenomic library the target DNA is generated usually by restrictionenzyme digestion of genomic DNA3 Vector A plasmid or a bacteriophage molecule which has to haveat least three distinct propertiesan origin of DNA replication such that the vector can replicateautonomously within the host andusually make multiple copies At a minimuma restriction enzyme site that occursonly once in the vector to allowfor the introduction of the target foreign DNAMost vectors available today have many restriction enzyme sites that occur only once in the vector to allow the use of different restriction enzymes for cloning of target DNA Called a Multiple cloning sitea selectable marker gene usually one conferring antibiotic resistance A Forth characteristic that is often presentbut not required is an ability to usea second form of selection namely the ability to make a specific enzyme called Bgalactosidase when the vector is empty ie no target DNA present You will learn aboutBgalactosidaseinseveral laboratories o The vector used in this laboratory calledpBluescript SK has this ability when transformed into particular Ecoli host cells4 Host A bacterium or sometimes a yeast strain which is used to propagate individual DNA moleculesTheEcoli host you will use iscalled XL1Blue These cells when transformed with pBluescript or similar vectors can make Bgalactosidase when 2
More Less

Related notes for BIOB12H3

Log In


Don't have an account?

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.