Class Notes (839,118)
Canada (511,196)
BIOC15H3 (28)
Lecture 3

BIOC15 Lecture 3 Wednesday September 11.doc

7 Pages
147 Views

Department
Biological Sciences
Course Code
BIOC15H3
Professor
Karen Williams

This preview shows pages 1 and half of page 2. Sign up to view the full 7 pages of the document.
Description
BIOC15 Lecture 3 Wednesday September 11, 2013  Mutant □ Something to do with change  Genetics: DNA □ Typically how we encounter today via mutant (forensic data/paternity identification)  Cystic Fibrosis □ What is the mutation in terms of the change (in delta F508)? - First step, ask the base pairs of DNA missing – results in the absence of phenylalanine (Phe) at the position 508 - Using the table p. 248 – single letter code  phenylalanine is F - Change in position that results in the absence of phenylalanine (Phe) - UUU – mRNA codon - Base pairs of DNA missing?  DNA TTT or TTC AAA AAG  How do mutations affect polypeptide structure and function? □ Point mutations: base-pair mutation - Transition mutation - Transversion mutation  Mutations classified by their effect on DNA □ Base-pair substitutions □ Transition: purine for purine or pyrimidine for pyrimidine □ Transversion: purine for pyrimidine or pyrimidine for purine □ Delta F508 was a deletion; whole chink of DNA is missing □ Mutations are classified how DNA is disrupted; first definition of mutation  Sequence of part of a normal gene vs. sequence of a mutated gene □ Transition A-T to G-C □ Transversion (C-G to G-C)  β-Globin □ Sickle cell; a normal Hb-A □ Change at DNA that leads to differences in mRNA that leads to differences in polypeptide □ Single base pair substitution (AU) □ Glu  Val □ For other hemoglobins, you can do the same thing  How do mutations affect polypeptide structure and function? □ What is the outcome of the protein product? Does it make the protein not functional? Etc.  Sequence of part of a normal gene vs. sequence of a mutated gene □ Missense - Change from one amino acid to another - Mutation will change the mRNa that changes the polypeptide it is coded for  Normal protein-coding gene vs. mutated gene □ What is happening at the DNA level at the template strand and how a translation is being changed with the triplet codon  Sequence of part of a normal gene vs. sequence of a mutated gene □ Neutral mutation - Change in DNA and it changes the mRNA (changes amino acid) - Type of amino acid is similar, has similar chemical properties  β-chain □ clinical significance □ Hb-C, hemoglobin variant C result in a less severe form of anemia than Hb-S because Glu is replaced by Lys (amino acid position 6) as opposed to Val in sickle cell anemia □ Glu and Lys are both hydrophilic; similar chemical properties  Amino acids with nonpolar R groups □ Hydrophobic □ Valine □ Hydrophilic  hydrophobic really changes the conformation and shape of the protein  Amino acids with uncharged R groups  Amino acids with charged R groups □ Lysine is basic □ Glutamic acid is acidic □ Effect of changing the amino acid may change the properties of the amino acid as in Hb-C resulting in a less severe form of anemia  Sequence of part of a normal gene vs. sequence of a mutated gene □ Frameshift mutation - Change in DNA sequences, changes mRNA and changes multiple amino acids downstream  Alkaptonuria □ Whole variety of mutations in alkaptonuria □ New England Journal of Medicine □ At these different positions there are a whole variety of different mutations in the homogentistic oxidase gene (HGO) □ Few blue coded mutation in HGO (missense mutations) □ Ex. looking a Q 159 H – single letter codes for amino acids and the location  Quiz □ If this is a partial strand of the wild type HGO gene pictured below: 3’ – TACCGGCTAACAATAGATCC □ And one mutation is: 3’ – TACCGGCTAACAAAAGATCC □ Using the genetic code which one of the following is the new amino acid sequence of the mutation? a) AUG GCC GAU UGU UAU CUA GGA b) Met Ala Asp Cys Phe Leu Gly c) 5’ – AUG GCC GAC UGU UUU CUA GGA d) Nonsense mutation e) Met Ala Ile Cal Ile STOP  Effect of mutation on gene expression □ Carcinogenic - Change in gene expression and promotes growth □ Decreased or stopped gene expression (also works for cancer) □ No protein for cell death  does not occur in cancer □ Mutations changes protein shape and conformation; also changes the way proteins react in particular reactions - Can get one change in a gene that leads to massive change in gene expression  produces another phenotype - Ex. ability to perceive light and react to light - Ex. ability of hemoglobin to react with oxygen - Ex. respond to timing  Phenylalanine hydroxylase (PAH) □ Not just a single mutation in PAH (there are many) □ Most alleles in PAH, inactivate the protein □ Without active protein/enzyme, you don’t not get the reactions proceeding □ Can have non-PKU = normal - Pp or PP □ Haplosufficient - In the half mode it is not sufficient; need two small p’s □ If you have enzyme activity, and you don’t have sufficient enzyme activity – the actions do not proceed □ In this case, if you only have one small p and one big P, you still make enough of the enzyme to be normal without having PKU □ If you have two small p’s you are unable to make sufficient enzyme so you do not have the phenylalanine hydroxylase □ Think of it in terms of the amount of enzyme □ If you cannot produce sufficient amount of the enzyme, you have the disorder □ Recessive vs. dominance; can be either for a va
More Less
Unlock Document

Only pages 1 and half of page 2 are available for preview. Some parts have been intentionally blurred.

Unlock Document
You're Reading a Preview

Unlock to view full version

Unlock Document

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit