BIOL 100 Lecture Notes - Lecture 24: Ribonucleoside, Okazaki Fragments, Isotopic Labeling

106 views3 pages

champagnebee70

23 May 2016

School

UM Dearborn, UMD

Department

Biological Science (BIOL)

Course

BIOL 100

Professor

Adler

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Is susceptible to mutations and can be changed or modified. It is replicated every time your cells divide. **dna has 2 purposes; to create more cells or to create proteins. He proved that dna contains the information that is required for replication: you need; Figured out how dna is replicated: 3 possible ideas; When each parent strand is used as a template for a new strand: old strand + new strand. An entirely new double helix will be created based on the original: both are new strands. When you have fragments of new and old dna pieces or molecules in both the old and the new dna strands: they end up proving that dna is replicated semi-conservatively. Radio-labeling nitrogen: all original dna in your cells contains n15 (the original sample) You then allow them to replicate in n14. This means any new dna constructed now has n14 because n15 is no longer there.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 100 Lecture Notes - Lecture 24: Ribonucleoside, Okazaki Fragments, Isotopic Labeling

Document Summary

Get access

Related Documents

BIOL 100 Lecture Notes - Lecture 32: Helicase, Short Strand, Telomerase

Biology 1001A Lecture Notes - Lecture 6: Noncoding Dna, Helicase, Replisome

Biology 1001A Lecture Notes - Lecture 9: Okazaki Fragments, Dna Clamp, Dna Replication

Related Questions