GCD 3022 Lecture Notes - Lecture 7: Ribosome-Binding Site, Start Codon, Rna Editing

60 views2 pages

taupeyellowjacket569

9 Mar 2018

School

UMN

Department

Genetics, Cell Biol/Development

Course

GCD 3022

Professor

Naoka Shima

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

According to the central dogma of genetics, dna is transcribed into mrna, and mrna is translated into a polypeptide. Dna replication allows the dna to be passed from cell to cell and from parent to offspring. A gene is an organization of dna sequences. A promoter signals the start of transcription, and a terminator signals the end. For genes that encode polypeptides, the gene sequence also specifies a start codon, a stop codon, and many codons in between. Bacterial genes also specify a ribosomal binding site. Transcription occurs in three phases called initiation, elongation, and termination. Many bacterial promoters have sequence elements at the -35 and -10 regions. During the initiation phase of transcription in e. coli, sigma factor, which is bound to rna polymerase, binds into the major groove of dna and recognizes sequence elements at the promoter. Following the formation of an open complex, sigma factor is released.

Related Questions

Match the following:

1	Region which lies upstream of thetranslation start site contains the Shine Dalgarno sequence
2	Sequence added to the 3' end of thepre-mRNA which affects mRNA stability
3	Establishes the reading frame andspecifies the first amino acid of the protein chain
4	DNA sequence that the transcriptionapparatus recognizes and binds to initiate transcription
5	Expressed sequences of DNA that arenot removed during alternative splicing
6	Signals the end of translation andthe protein molecule
7	Group of three nucleotides that codefor an amino acid
8	Site begins the coding region of thegene and is located 25-30 nucleotides downstream of the TATAbox
9	Non-coding sequences of DNA thatintervene within coding regions of a gene
	10 Ribosome binding site ineukaryotes; functions in the initiation of translation and mRNAstability
11	A sequence which lies downstream ofthe coding region of the gene; determines the location of the 3'cleavage site in the pre-mRNA molecule
12	Sequence of nucleotides at the 3' endof the mRNA that is not translated into protein; affects thetranslation and stability of the mRNA molecule

A.	5' untranslated region
B.	AAUAAA consensus sequence
C.	Promoter
D.	Transcription start site
E.	3' untranslated region
F.	Introns
G.	Initiation codon (AUG)
H.	Poly(A) tail
I.	5' cap
J.	Termination codon (UAA, UGA, UAG)
K.	Exons
L.	Sense codon

ivorymacaw91

Here you have the non-template strand of DNA sequences of genomic DNA and mRNA of the human insulin gene (1431nt long from +1nt).

â¦â¦â¦.CAATâ¦..<60nt>â¦..TATA..<28nt>..AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC

The mRNA strand is as follows:

mRNA sequence (465nt long)

AGCCCUCCAGGACAGGCUGCAUCAGAAGAGGCCAUCAAGCAGAUCACUGUCCUUCUGCCAUGGCCCUGUGGAUGCGCCU CCUGCCCCUGCUGGCGCUGCUGGCCCUCUGGGGACCUGACCCAGCCGCAGCCUUUGUGAACCAACACCUGUGCGGCUCA CACCUGGUGGAAGCUCUCUACCUAGUGUGCGGGGAACGAGGCUUCUUCUACACACCCAAGACCCGCCGGGAGGCAGAGG ACCUGCAGGUGGGGCAGGUGGAGCUGGGCGGGGGCCCUGGUGCAGGCAGCCUGCAGCCCUUGGCCCUGGAGGGGUCCC UGCAGAAGCGUGGCAUUGUGGAACAAUGCUGUACCAGCAUCUGCUCCCUCUACCAGCUGGAGAACUACUGCAACUAGA CGCAGCCCGCAGGCAGCCCCACACCCGCCGCCUCCUGCACCGAGAGAGAUGGAAUAAAGCCCUUGAACCAGC

QUESTIONS:

1) Label the following on the DNA strand:

a) +1 position

b) upstream and downstream sequence relative to +1 nucleotide

c) Promoter region

d) Exons

e) introns

f) splicing signals (dinucleotides)

2. Label the following on the mRNA strand:

a) Start codon

b) stop codons

C) Kozak sequence

3. If you placed this gene (human insulin) in a bacterial cell, do you think a functional insulin product will be made? Why or why not?

22. What is probably the single most important distinction between bacteria and eukaryotes?

a. transcription

b. the separation of the cell's genetic material from the surrounding cytoplasm

c. the existence of ribosomes

d. RNA processing in bacteria

e. antibiotics

23. Which one does NOT characterize an open reading frame (ORF)

a. Uses six reading frames during translation

b. Contains a start codon

c. Contains a stop codon

d. Its length is in multiples of 3 nucleotides

e. It should have the number of codons for a protein or on average ~250 codons in length.

24. Nested intronic genes lie within the non-coding intronic region of a larger gene, and occur in the human genome.

a. True

b. False

25. How would you characterize this statement: EF-Tu will hydrolyze GTP only if the codon:anticodon & tRNA:amino acid matchings are correct

a. Transcription; initiation steps

b. Transcription; termination steps

c. Translation: initiation steps

d. Tanslation: elongation steps

e. Spliceosome

26. Regarding the transcription unit architecture of the Escherichia coli genome, which one is FALSE?

a. Each of the 4,661 transcription units comprised an average of 1.1 modular units.

b. 3,010 transcription units (~65%) are monocistronic.

c. 1,652 transcription units (35%) contain more than one ORF (polycistronic)

d. The largest transcription unit is equivalent to 16 ORFs with numerous introns.

e. 398 transcription units (~9%) are nested within each other in opposite transcriptional orientation

27. Regarding RNA interference (RNAi), which one is FALSE?

a. It is a common and conserved mechanism in eukaryotic cells.

b. Originally discovered in bacteria and plant viruses.

c. A form of primitive immunity to protect the genome.

d. Pre microRNA (miRNA) genes have been found in introns.

e. Recent research shows that exogenous plant miRNAs in food can regulate the expression of target genes in mammals.

28. Aminoacyl-tRNA synthetases

a. Recognize the 3âUTR

b. The genes for these enzymes fall into the family of inducible genes

c. The enzymes are imported into the nucleus

d. Covalently attaches an amino acid to the appropriate tRNA. This takes place in the cytoplasm.

e. Forms the peptide bond during protein synthesis

29. What is the process by which complementary RNAs are made from a DNA template?

a. translation

b. transcription

c. protein synthesis

d. transduction

e. transliteration

cyanbee225

GCD 3022 Lecture Notes - Lecture 7: Ribosome-Binding Site, Start Codon, Rna Editing

Document Summary

Get access

Related Documents

GCD 3022 Lecture Notes - Lecture 9: Start Codon, Transfer Rna, Alpha Helix

BIOL 2344 Chapter Notes - Chapter 12: Nucleolus, Transcription Factor Ii H, Guanosine

BIOL 1000 Chapter Notes - Chapter 13.2: Neurospora Crassa, Tata Box, Alkaptonuria

Related Questions