3.What is transcription? What is needed for it to occur? What are the 2 major parts of a gene?

8. For translation to occur you need 3 RNAs. What are they and what do they do?

10. How can you know the sequence of a protein from a DNA sequence? What would you do to figure out where the genes were if you know exactly where the promoter sequences were throughout the genome?

answer

watching

109

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Tod ThielLv2

22 Jun 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

1. Bacterial transcription initiation

a. What are the major components of a bacterial promoter? Do you understand their nomenclature (i.e. how are they related to the transcription start site)?

b. What is the function of each promoter element during initiation?

c. What sequence-based factors contribute to promoter strength?

d. Why are there multiple sigma factors? How do they function to turn on different genes?

e. Why are short (<10 nt) abortive products possible during transcription intiation? What happens to RNAP when these products are released?

f. What changes in the RNAP holoenzyme occur following promoter escape?

champagnewombat671

What are transcription factors? In which groove would you expect them to bind on DNA?

How do the genome, transcriptome and proteome compare in complexity? Which of the following would you expect to be in the exome; introns, exons, 5â UTRs, 3â UTRs, promoter sequences?

You are comparing sequences among different species, and you find some sequences are highly conserved. What would you predict would happen if a mutation occurs in a sequence that is highly conserved evolutionarily?

If you discover a highly conserved sequence that is 5â to the start of transcription, what would you expect mutations in that sequence to do?

a. Reduce fitness

b. Alter gene expression

c. Alter the structure of a protein or proteins

d. All of the above

e. a) and b), but not c)

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.