BIOLOGY 2C03 Lecture Notes - Birth Weight, Attention Deficit Hyperactivity Disorder, Small Nuclear Ribonucleoprotein Polypeptide N

44 views5 pages

lilacdog276

5 Nov 2013

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Genomic imprinting: epigenetic process that involves dna methylation and histone modifications in order to achieve monoallelic gene expression without altering the genetic sequence. Epigenetic marks established in the germline and are maintained throughout all somatic cells of an organism. The expression of genes is determined by whether the gene is inherited from the mother or the father. Not changing the nucleotide sequence or the genetic sequence of the dna. Genomic imprinting: the expression of genes is determined by whether the gene is inherited from the mother or father. This is an example of an inherited form of dna modification that alters gene expression or epigenetics. Mice inheriting a deletion of this gene from their father were small (60% of normal birthweight) Mice inheriting the deletion from their mother were normal. Not the sex of the offspring but the sex of the parents that determine whether the phenotype will be expressed.

Related Questions

Epigenetic modifications to DNA sequences and resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat it with sodium bisulfite. a.) If your original DNA sequence is: ACAGTCCGTCGGAGCCTGCCAGTCGCACCT and your sequence after treatment reads: ACAGTTCGTCGGAGCTTGTTAGTCGCACTT, which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred to a new sequence? Indicate what the new sequence will be in the standard 5' to 3' direction. c.) How does an increase in DNA methylation affect chromatin structure and what does this do to gene expression? Be specific. d.) Describe how chromatin structure is altered in the process of X-inactivation and how the active X-chromosome prevents itself from being inactivated. Include the functions of Jpx, Xist, Tsix, and describe what each of these gene products do. Be specific.

Genetics Question

QUESTION 3

What is the purpose of chromatin-remodeling enzymes in human cells?

The enzymes control the rate of translation of an mRNA transcript

The enzymes add phosphate or methyl groups to histone tails

The enzymes slide nucleosomes farther apart or closer to each other

The enzymes send damaged proteins to the proteasome for degradation

The enzymes cause DNA looping to occur

QUESTION 10

If you can drink milk as an adult, it means that you have inherited a mutation in the an enhancer for your lactase gene (the gene that encodes the enzyme you need to break down lactose). Predict the effect of this mutation:

The mutation changes the number of domains in the enzyme, which makes it work more efficiently

The mutation changes the amino acid sequence of the lactase protein

The mutation increases the number of copies of the lactase gene that will be found in your genome

The mutation changes whether the lactase sequence is found in an intron or exon

The mutation affects the expression of the lactase gene

QUESTION 12

What determines where in the genome a transcription regulator will bind?

Transcription regulators bind to the 5' UTR region of a gene

Regulators bind via complementary base-pairing to certain DNA molecules

Covalent bonds form between the transcription regulator and the atoms of the DNA backbone

Every eukaryotic gene has a different transcription regulator that will bind to the 5' end of the gene

Transcription regulators bind to specific DNA sequences via multiple weak non-covalent interactions

QUESTION 15

What is the histone code used for?

		Phosphorylation and acetylation of DNA affect its ability to be compacted
		Changes to the sequence of DNA change whether DNA will wrap around histone proteins
		Covalent modifications of histones affect the ability of the transcription initiation complex to form
		Histones provide the codon sequences needed for translation to occur
		The histone code affects which amino acids will get added to a polypeptide

Match the following definitions with the correct term. (We have not yet cover all of them in class, but you can find them in your reading.)