BIOL 1011 Study Guide - Valine, Transfer Rna, Operon
Get access
Related Documents
Related Questions
DNA Structure and Function LabReport
- DNA Structure
- Which two scientists are credited with discovering DNA?
- Name the nitrogen bases that are purines.
- Which nitrogen base pairs with thymine?
- List the three components of a nucleotide.
- DNA Replication
- What is the purpose of DNA replication?
- How many times does replication occur in the life of acell?
- In the Lab, Exercise 2, the original strand on the left had thebases shown below. Input the new bases that correctly pair with theoriginal strand.
Original | New |
C | |
A | |
G | |
T |
- RNA Structure
- Describe the structure and function of RNA.
- Refer to Exercise 3 and record the bases of the RNA strandproduced from the replicated DNA strand.
DNA | RNA |
C | |
A | |
G | |
T |
- Record the differences between DNA and RNA in the tablebelow.
DNA | RNA | |
Sugars | ||
Bases | ||
Strands |
- RNA Synthesis
- The process of assembling RNA is called _________.
- How is replication different from transcription?
- Refer to Exercise 4. Write the letters for the base sequence ofmRNA in the spaces below DNA. Note that the order is reversed;start with the 3â end of the DNA strand and the 5â end of the mRNAstrand. Transcription is DNA to mRNA. Note RNA contains Uracilinstead of Thymine; There is no thymine in RNA.
DNA | 3â | C | G | T | C | G | T | C | C | A | A | T | T | 5â |
mRNA | 5â | 3â |
- Protein Synthesis
- What type of RNA provides amino acids to build polypeptidechains?
- If a mRNA strand has the bases 5â CUC 3â, what amino acid willbe translated? Refer to the printable chart in Exercise 5.
- Where in the cell does translation occur?
- Genes
- What could be the problem if there is a change in the basesequence of a gene as it is passed down to the offspring?
- Give an example of a disorder that results from changes in theamino acid sequence.
- What causes sickle cell anemia?
- Gene Cloning
- What is the function of a plasmid?
- Print the document from Lab, Exercise 6. Complete the activityalong with the video demonstration. Sign, date, and take an imageof your final product and include with this lab report.
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?