m7mdeljoker

What are the chief problems and concerns facing Aboriginal youth?

How will you, in your capacity as a youth worker, support your client in overcoming these problems?

GDB of Physics PHY101

“We are observing wasted heat in everyday life for example in Pakistan heavy generated are installed, during their supply of electricity an excessive amount of wasted heat is produced in its surrounding, similarly when we drive a vehicle a heat is available in the surrounding of engine of that vehicle, we can also see many more such examples of wastage of heat. This heat is effecting the environment of Pakistan badly.

Is it conceivable to convert this wasted heat into some useful work/energy/electricity or not. If yes how? If no why?”

1. Paid three months’ rent on a lease rental contract, $6,000.
2. Paid the premiums on property and casualty insurance policies, $2,400.
3. Received cash from clients as an advance payment for services to be provided and recorded it as unearned fees, $2,700

Why is it important for an educational administrator to keep up with current events in education?

A. They need to make sure that their school is up to date on current trends in teaching.

B. They need to make sure they are keeping up with world events.

C. They need to make sure that the district is following state nutritional guidelines.

D. They need to make sure that teachers are working on the weekend grading papers.

It is important for an architectural manager to be aware of how the ____________ affects the people working on the project.

A. location of the job site

B. reliability of the internet

C. education of the foreman

D. atmosphere of the workplace

2. In your own words, discuss the history of New Mexico as one of both cultural conflict and cultural exchange. Where do the religious beliefs of Catholic explorers and Native Americans overlap? Whare do they diverge? (at least 5 complete sentences).

How do they overlap?

Architecture Evaluation (4 paragraphs)

In the first paragraph you will have a thesis about what you will discuss in your writing and the introduction of what defines architecture. In the second, third and fourth paragraph you will explain three types of architecture and how they are represented in the world and in the last paragraph you will conclude by explaining the importance of architecture and your opinion about it.

what sequence of amino acids is produced by a ribosome latching onto your strand of RNA?

be sure to identify the correct position where the ribosome attaches to the RNA strand

Strand 1: CUAUGGGUAUUCGUCCCUACUGACAAG

Strand 2: CUAUGGGUAGUCGUCCCUCAUGACAAG

Strand 3: CUAUGGGUACUCGUCCCUCAUGACAAG

A complex of ribosome attached to a single strand of RNA is known as ?

“We are observing wasted heat in everyday life for example in Pakistan heavy generated are installed, during their supply of electricity an excessive amount of wasted heat is produced in its surrounding, similarly when we drive a vehicle a heat is available in the surrounding of engine of that vehicle, we can also see many more such examples of wastage of heat. This heat is effecting the environment of Pakistan badly.

Is it conceivable to convert this wasted heat into some useful work/energy/electricity or not. If yes how? If no why?”

What you know about RA 3019- Anti Graft and Corrupt Practices?

What you want to know about RA 3019- Anti Graft and Corrupt Practices?

What you have learned about RA 3019- Anti Graft and Corrupt Practices?

Would you expect to see d-d transitions from Co2+ dopants in ZnO? If yes, then do you expect it to be as intense as the band gap transition? Explain why or why not.

Assume D is bounded, f maps D to R is continuous. , the IntegraD or f exists. Prove or Disprove: D has area.

1. Balance equation _Ag2+ ______Al —->Ag+ ___Al2S3

     1a) Explain how the above chemical reaction relates to the activity series of metals

2. If 1.356mol of Ag2S reacts with 0.772mol of Al, determine the theoretical yield of aluminum sullied using the steps :

- determine the limiting reactant

- determine made of aluminum sulfide

If the actual yield of Al2S3 was 41.8g. Determine the percent yield

A 6.22 kg mixed-mineral sample contains chromite (FeCr2O4) as the only chromium-bearing ore. The sample is subjected to an industrial process, using a ferrosilicon alloy as a reducing agent, which quantitatively converts all of the chromium into 11.9 kg of a ferrochrome alloy (stainless steel) which is 18.9% Cr by mass.

What is the percentage of chromite (FeCr2O4) in the original sample?

Draw the Lewis structure for vinyl bromide C2H3Br. Be certain you include any lone pairs.

Anything about black hole?

What is an different at moment as salcarmoation?

Please explain to me the peripheral nervous system and the two types of it. 

1. On Jan. 2, Callie Company received a $700 payment from a customer previously billed for services performed. The journal entry to record this transaction would include a (debit, credit) to the account and a (debit, credit) to the Accounts Receivable account.

Calculate the pH in a 0.00270 M oxycodone solution. Express your answer using three significant figures. pH = 9.97 SubmitMy AnswersGive Up Correct Significant Figures Feedback: Your answer 9.92 was either rounded differently or used a different number of significant figures than required for this part. Part B Calculate the concentrations of C18H21NO4 in a 0.00270 M oxycodone solution. Express your answer to two significant figures and include the appropriate units. SubmitMy AnswersGive Up Part C Calculate the concentrations of HC18H21NO+4 in a 0.00270 M oxycodone solution. Express your answer to two significant figures and include the appropriate units. SubmitMy AnswersGive Up Part D Calculate the concentrations of H3O+ in a 0.00270 M oxycodone solution. Express your answer to two significant figures and include the appropriate units. SubmitMy AnswersGive Up Part E Calculate the concentrations of OH− in a 0.00270 M oxycodone solution. Express your answer to two significant figures and include the appropriate units.

Oxycodone (C18H21NO4),a narcotic analgesic, is a weak base with pKb=5.47.

Calculate the pHin a 0.00250Moxycodone solution.

Which I got the answer of pH = 9.96

How do I do the rest of these?

b. Calculate theconcentrations of C18H21NO4 in a 0.00250Moxycodone solution?

c. Calculatethe concentrations of

HC18H21NO+4 in a 0.00250Moxycodone solution.

d. Calculate theconcentrations of

H3O+ in a 0.00250Moxycodone solution.

e. Calculate theconcentrations of

OH? ina 0.00250Moxycodone solution

What is gravitation? 

1. Would you have joined one of these parties during the Depression? Why or why not? 

2. Why do you think there were Canadians joining radical political parties like the Communist Party of Canada or the Canadian Union of Fascists? 

3. Alliances were being formed, dictatorships were rising, and tensions were growing in Europe as a result of the new borders outlined by the Treaty of Versailles. Should Canada be concerned? Be sure to give a reason if you select this question

As a steward of change, how will you promote Innovation without compromising the values, culture and tradition in our country?

1. What happened to make this historical information appear? (why people write this reading?) 
2. What impacts did it have on society at that time?
3. What impacts does it have on future generations?
4. What is its importance to history

what happened during ww1? 

Great Depression.

Explain what caused the Great Depression?

What happened during this time?

Be sure to mention the Stock Market Crash of 1929 as part of your answer.

The narrator of the account in document 2 explains,

“Their dogs are enormous, with flat ear, and long, dangling tongues. The color of their eyes in is burning yellow; their eyes flash fire and shoot off sparks.”

Which statement below best explains the historical significance of that description?

◯ A. This passage helps historians understand the implications of both the biological and technological exchange that occurred at the time the Spaniards arrived in America.

◯ B. This passage reveals how the native Americans looked down on the Spanish as weak and soft, because they seemed lazy and lacked physical fitness.

◯ C. The natives could relate to the newcomers, due to the similarity of their animals, which shows the universality of the human experience.

◯ D. This passage provides proof that the indigenous people of what is now Mexico were much shorter than Euoropeans of that time.

Pros and Cons of federal government involvement in elections

2. Why do you think there were Canadians joining radical political parties like the Communist Party of Canada or the Canadian Union of Fascists? 

Please write out all steps

We have a crystal structure of an ordered magnetic Fe-Pt alloy. There are 10 Pt atoms and 4 Fe atoms. The length of each edge is l=0.39 nm. For X-ray diffraction analysis the wavelength is λ=0.154 nm.

a. What is the lattice constants of this crystal structure?

b. Will you be able to observe (001) diffraction peak of this ordered Fe-Pt alloy in X-ray diffraction? If so, calculate the corresponding diffraction peak position, 2θ (θ is the diffraction angle). If you cannot see a diffraction peak, explain why.

EXPLAIN why the location of H atoms by x-ray diffraction ic difficult. WHAT technique & WHY , is used for the accurate determination of H atom positions in a structure? Comment on any limitations of this method.