shivammaddheshiya537

shivammaddheshiya537

Lv10

shivammaddheshiya537University of Lucknow

3 Followers
0 Following
0 Helped

ANSWERS

Published1049

Subjects

Project Management1History4Management79Music2English32Philosophy55Anthropology6Astronomy16Business22Science106Electrical Engineering32Sociology72Geography35Psychology24Information Technology6Probability1Computer Science3Accounting38Biology414Statistics41Physics7Economics19Chemistry34
Answer: option B
Answer: option D
Answer: option 2

A molecule binds and blocks a potassium channel in a plant cell membrane. What would be its effects?

Potassium uptake would be blocked because the proton pump would no longer work.
Potassium uptake would be unchanged since potassium readily crosses through the cell membrane's lipid bilayer.
Potassium uptake would be blocked since potassium ions enter cells through facilitated diffusion.

Potassium uptake would be unchanged since uptake is by active transport by pumps.

2. What nutritional benefits can insects provide to carnivorous plants?

The carnivorous plant Nepenthes bicalcarata ("fanged pitcher plant") has a unique relationship with a species of ant − Camponotus schmitzi ("diving ant"). The diving ants are not digested by the pitcher plants, but instead live on the plants and consume nectar. Diving ants also dive into the digestive juices in the pitcher, swim to the bottom, and capture and consume trapped insects, leaving uneaten body parts and ant feces behind. What nutritional impact do the ants have on fanged pitcher plants? Do the pitcher plants derive any nutritional benefit from this relationship?

Part A

Researchers tested the hypothesis that the relationship between diving ants and pitcher plants is mutualistic (i.e., both species derive a nutritional benefit). To do so, they compared leaf surface area (as a measure of overall growth) in two sets of pitcher plants: plants with diving ants and plants without. The results are shown in the graph. The P values indicate whether or not there is a significant relationship between the size of the host plants and the surface area of the host plants' leaves. Based on this graph, what conclusions can be drawn about the impact of diving ants on overall plant growth?

Source: Bazile, V. et al. 2012. PLoS ONE 7: e36179.

the terms on the left to the appropriate blanks on the right to complete the sentence

positive

negative

with

without

Plants ______ diving ants show significantly larger total leaf surface area than plants ants. Plants ________ ants grow taller without any significant increase in leaf surface area. In plants ______ ants, however, leaf surface increases significantly as the plants grow taller. Therefore, diving ants have a ______ impact on overall plant growth.

Please answer all four blanks from above options.

Comments
    Answer: option 2
    Answer: option C
    Answer: Option C
    Answer:False.
    Answer: option 2
    Answer: option A
    Answer: option B
    Answer: option a
    Answer: option B
    Pleeeeeease answer all the questions!!!!!

    Show transcribed image text
    Answer: option A
    Answer: option A
    Answer: option A
    Answer: false.
    Answer: option 2
    Answer: option B
    Answer: option D
    Answer:An active process is a process that requires the use of energy. Inspira...
    Answer: option A

    The experiment shown in Figure 12.10 was done using cytoplasm. What could the investigators do to determine whether the regulatory molecule was present in the cytosol or in a cytoplasmic organelle?

    A- Use radioactive isotope labeling to separate the organelles and cytosol from M-phase cells and microinject only the organelles into the frog oocytes

    B- Use fluorescent labels to separate the organelles and cytosol from M-phase cells and microinject only the organelles into the frog oocytes.

    C- Use differential centrifugation to separate the organelles and cytosol from M-phase cells and microinject only the organelles into the frog oocytes.
    D- Use gel electrophoresis to separate the organelles and cytosol from M-phase cells and microinject only the organelles into the frog oocytes.

    Answer: option B
    Answer: option A
    Answer: option 4
    Answer: option 1

    The uvrC gene encodes one of the proteins in E. coli nucleotide excision repair. When extracts of E. coli are incubated with the DNA fragment shown below, the mutation shown will be repaired. Note: The ‘T=T’ represents a thymine dimer, while the ‘A.A’ is the undamaged strand (the ‘.’ is just for proper spacing of the rest of the strand). 5'GTAACTATGATGGATAGACCGACAGGGGGACCAGTTG(T=T)GCGGGAGAGACCTTTAGATGAC3’ 3'CATTGATACTACCTATCTGGCTGTCCCCCTGGTCAAC(A.A)CGCCCTCTCTGGAAATCTACTG 5’

    a. If an extract was used in which the uvrC protein could only cut the DNA on the 5’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

    b. If an extract was used in which the uvrC protein could only cut the DNA on the 3’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

    It is to my understanding that in the case of nucleotide excision repair that an uvrA uvrB complex identifies and isolates a problematic "bulky lesion". The complex recruits uvrC which cuts on either side of the damaged area approximately 5-8 nucleotides away. uvrD then is recruited to remove the cut strand. Given this question I assume that if you had a modified uvrC that could either only cut on the 5' or 3' end the segemnt including the damaged area could not be removed by uvrD in both cases meaning ultimately DNA polymerase/Ligase could not come in and fix things which means the segment could not be repaired. Am I correct in my thinking, or is there something I'm missing?

    Answer: option A
    Answer: option 3
    Answer: option C
    Answer: option 1
    Answer: option C
    Answer: option A
    1) The _________ is a site on a DNA strand where the two strands are separated in preparation for DNA replication.
    a) origin of the replication b)replication fork c) Okazaki fragment d) RNA primer

    2)An enzyme called ____ joins the 3' end of a dna fragment to the 5' end of another okazaki fragment during dna replication.
    a) DNA polymerase III b) DNA ligase c) Topoisomerase d) None of these

    3)In what direction can elongating dna strands grow (i.e in what direction are new DNA nucleotides added to a growing DNA strand)?
    a)3' to 3' b)3' to 5' c)5' to 3' d) 5' to 5'

    4)Which enzyme removes an RNA primer and replaces it was dna nucleotides?
    a)DNA polymerase III b)Helicase c)Primase d) DNA polymerase I

    5)If 30% of the DNA nucleotides in a particular eukaryotic cell are adenine, what percentage of the dna is made up of guanine?
    A) 40% B)30% C)20% D)None of these

    6)DNA that has been packages up with histones and other proteins in the nucleus of a eukaryotic cell is called__________.
    a)chromosones b)chromarin c)sister chromatids d)nucleosomes

    7)Which enzyme adds new nucleotides to a growing DNA strand during DNA replication?
    a)DNA polymerase III b) Helicase c)Primase d) DNA polymerase I

    8)Which of the following proteins binds to DNA strands that have been separated in preparation for DNA replication?
    a)Primase b)single-strand binding protein c)Ligase d) DNA polymerase I

    9)An enzyme called _______ separates a DNA strands about ot undergo replication, cuasing over winding strain. this stress is relieved by an enzyme called _________ that cuts overwound DNA , rotates it, and rejoins it ot the DNA strand.
    a) DNA polymerase III; primase b)Helicase; DNA ligase c)Helicase; topoisomerase d)Topoisomerase; single-strand binding protein

    10) Write out the complementary sequence to the parental DNA strand given below. Make sure to indicate directionality.
    5'-ATCGCCTTACGAATG-3'
    Answer: option C
    Answer: option A

    1) A mutation that changes a codon sequence, and subsequentlychanges the amino acid that should have been placed at that pointin the polypeptide chain, is called a

    A. frameshift mutation.

    B. missense mutation.

    C. silent mutation.

    D. nonsense mutation.




    2) A mutation that changes a codon that originally coded for anamino acid into a stop codon is called a

    A. frameshift mutation.

    B. missense mutation.

    C. silent mutation.

    D. nonsense mutation.




    3) Assume that a new low-calorie sweetener is developed. Thestructure is novel and is tested with the Ames test formutagenicity. The following results are obtained:

    Sample Number of his+ revertant colonies

    distilled water 2

    distilled water + rat liver enzymes 3

    Sweetener 1

    sweetener + rat liver enzymes 805


    What conclusion is most consistent with this data?

    A. The sweetener is not mutagenic.

    B. Rat liver enzymes are highly mutagenic.

    C. The sweetener is not mutagenic but can be converted intostrong mutagens.

    D. The sweetener is mutagenic and can be converted into strongmutagens.

    E. The sweetener and its conversion products are equallymutagenic.




    4) What protein makes Okazaki fragments?

    A. primase.

    B. helicase.

    C. DNA polymerase III.

    D. DNA polymerase I.

    E. ligase.



    5) In the modification of eukaryotic mRNA, a "cap" consisting ofa/an _________ and a tail consisting of _______ are usually addedto the transcript.

    A. acetyl group; multiple cytosines

    B. multiple guanines; methyl group

    C. multiple thymines; acetyl group

    D. methyl group; multiple adenines



    6). RNA polymerase binds to a sequence called a/an______________ before beginning transcription.

    A. promoter

    B. operator

    C. structural gene

    D. replication origin




    7) In Sanger (enzymatic extension) sequencing, what causes DNAsynthesis to terminate at a specific base?

    A. chemicals that cleave DNA after particular bases

    B. fluorescent chemicals

    C. nucleotide triphosphates that lack a base

    D. nucleotide triphosphates that lack a hydroxyl

    E. nucleosides that lack a 5' phosphate



    8) What are differences between chromosomes of most prokaryotesand those of eukaryotes?

    A) The prokaryotic chromosome is linear, while the eukaryoticchromosome is circular.

    B) The prokaryotic chromosome is circular, while the eukaryoticchromosome is linear.

    C) The prokaryotic chromosome has one origin of replication,while eukaryotic chromosomes have several.

    D) The prokaryotic chromosome does not have nucleosomes, whilethe eukaryotic chromosome does.

    E) The prokaryotic chromosome is not necessary for theorganism's survival, while the eukaryotic chromosome is.



    9) As helicase unwinds the DNA molecule, what keeps the strandsapart?

    A) DNA polymerase

    B) Reverse transcriptase

    C) Replication fork

    D) Single-strand binding proteins

    E) Okazaki fragments



    10) Which enzymes are responsible removal of the RNA primers andreplacement with DNA nucleotides and repairing the single-strandednick adjacent to Okazaki?

    A) DNA primase

    B) DNA polymerase I

    C) DNA polymerase III

    D) DNA ligase

    E) DNA polymerase II



    11) Which enzyme activity is associated with the proofreadingmechanism of DNA polymerase I?

    A) 5'-to-3' exonuclease activity

    B) 3'-to-5' exonuclease activity

    C) 5'-to-3' polymerase activity

    D) 3'-to-5' polymerase activity


    12) Which type of RNA is found only in eukaryotes?

    A) mRNA

    B) tRNA

    C) rRNA

    D) snRNA


    13) During transcription, the synthesis of the mRNA strandproceeds in which direction?

    A) 5' to 3' only

    B) 3' to 5' only

    C) Both 5' to 3' and 3' to 5'

    D) Either 5' to 3' or 3' to 5'

    E) First 5' to 3', and then 3' to 5'




    14) Which of the following are true?

    A) Prokaryotes have only one kind of RNA polymerase, but severaldifferent sigma factors

    B) Prokaryotic messages are polycistronic.

    C) In eukaryotes, small ribosomal subunit binds to 5%u2019methylated cap and migrates to AUG start codon.

    D) In eukaryotes, the mRNA can only be translated by oneribosome at a time.

    E) Exons are spliced out of prokaryotic mRNAs

    F) Initiating tRNA in prokaryotes is fMet.

    G) Eukaryotes, nuclear membrane prevents coupling oftranscription and translation.

    H) In eukaryotes, translation continues until the ribosomeencounters the poly-A tail.




    15) Every amino acid contains

    A) an amino group

    B) an acetyl group.

    C) a hydroxyl group

    D) a carboxyl group

    E) an R group


    16) What is the role of tRNA in translation?

    A) It brings together two subunits of a ribosome.

    B) It couples an amino acid with aminoacyl-tRNA synthetase.

    C) It helps fold up the finished polypeptide chain.

    D) It catalyzes peptidyl transferase activity.

    E) It binds to an mRNA codon and carries the corresponding aminoacid




    17) But the following steps of translation in prokaryotes inorder:

    _____ Termination of translation is signaled by one of threestop codons

    _____ An Aminoacyl-tRNA binds to the ribosome in the A site

    _____ The small subunit binds to the Shine-Dalgarno sequence

    _____ The ribosome moves along the mRNA one codon toward the3%u2019 end

    _____ The small subunit of migrates to the region of the mRNAcontaining AUG codon

    _____ The large subunit binds to the small subunit

    _____ A peptide bond is formed between the amino acids in the Pand A sites

    _____ A special initiator tRNA binds to the AUG


    Answer: option A
    Answer: option B
    Answer: option A
    Answer: option C
    Answer: Option A
    Answer: option 2

    15. A 37-year-old man becomes acutely ill with fever, chills, nausea, and a painful stiff neck. Suspecting meningitis, the physician orders a lumbar puncture, which contains many white blood cells and organisms. Which of the following is the most common causative agent of bacterial meningitis in adults?

    a. Haemophilus influenzae

    b. Listeria monocytogenes

    c. group B Streptococcus

    d. Escherichia coli

    e. Streptococcus pneumoniae

    16. Angiography in a 64-year-old woman reveals a laterally expanding lesion within the cavernous sinus. Further tests confirm that this lesion is an aneurysm of the internal carotid artery. Which of the following is affected first by this expanding lesion owing to its approximation to the internal carotid artery?

    a. The maxillary nerve

    b. The trochlear nerve

    c. The mandibular nerve

    d. The oculomotor nerve

    e. The abducens nerve

    17. A 32-year-old woman becomes acutely ill with fever, pain in the orbits, and diplopia. The neurologist discovers that she has a severe maxillary sinus infection that has spread into her nose and onto the face. The examining physician concludes that this patient has a venous thrombosis. Based on their location and venous connection, which of the following is the most likely venous structure involved in this patient?

    a. Straight sinus

    b. Transverse sinus

    c. Vein of Labbé

    d. Cavernous sinus

    e. Superior sagittal sinus

    18. The caudal end of the spinal cord (conus medullaris) is anchored to the inner aspect of the spinal dural sac by which of the following?

    a. Filum terminale externum

    b. Filum terminale internum

    c. Coccygeal ligament

    d. Denticulate ligament

    e. Arachnoid trabeculae

    A 47-year-old man complains of slowly progressing weakness of both “legs.” On examination he has a flaccid paralysis of both lower extremities, muscle fasciculations, hypotonia, and areflexia. In addition, there is loss of pain and temperature sensations over the anterior aspect of both lower extremities and most of the feet but sparing the little toes.

    19. The flaccid paralysis, fasciculations, hypotonia, and areflexia in this patient are most likely the result of damage to what structures?

    a. Lateral corticospinal tracts

    b. Posterior (dorsal) roots

    c. Anterior (ventral) horn cells and alpha motor neurons

    d. Reticulospinal/vestibulospinal tracts

    e. Afferent fibers involved in monosynaptic reflexes

    20. The MRI of a 69-year-old woman reveals a tumor in the posterior fossa resulting in significant compression of the medulla. Which of the following deficits could appear suddenly in this patient and would signal potential medullary failure?

    a. Agnosia

    b. Paralysis of the lower extremities

    c. Complete loss of pain and thermal sense from the body

    d. Central apnea

    e.Blindness

    Answer: option C

    Weekly leaderboard

    Start filling in the gaps now
    Log in