shivammaddheshiya537

What would be the effect of an antibiotic that inhibits autolysins on bacterial cell division? ​

A) It would inhibit cellular elongation.

B) It would inhibit septum formation.

C) It would inhibit cell separation.

D) A and B.

E) A,BandC.

Which of the following is the most likely explanation for the observation that herbivores must have larger GI tracts for a given body mass than carnivores?

A. Herbivores and carnivores have similar metabolic rates; herbivores must consume a greater mass of food per unit time to meet metabolic needs, because the rate of extraction of energy and nutrients per unit mass of consumed food is lower in herbivores than in carnivores.

B. Herbivores and carnivores have similar metabolic rates, but carnivores only have to extract half as much energy and nutrients from the food they consume.

C. Food is more abundant in the environment for herbivores than for carnivores, so herbivores eat more than carnivores. In other words, herbivores are similar to many humans in that they have trouble controlling their impulsive eating behavior.

D. Herbivores have higher metabolic rates than carnivores and thus must eat more food.

What nutritional benefits can insects provide to carnivorous plants?

The carnivorous plant Nepenthes bicalcarata ("fanged pitcher plant") has a unique relationship with a species of ant − Camponotus schmitzi ("diving ant"). The diving ants are not digested by the pitcher plants, but instead live on the plants and consume nectar. Diving ants also dive into the digestive juices in the pitcher, swim to the bottom, and capture and consume trapped insects, leaving uneaten body parts and ant feces behind. What nutritional impact do the ants have on fanged pitcher plants? Do the pitcher plants derive any nutritional benefit from this relationship?

Part A

Carnivorous plants and legumes (e.g., peas, soybeans) both absorb key nutrients directly from other organisms. How is nutrient acquisition in pitcher plants similar to that in legumes? How is it different?

Drag the appropriate items to their respective bins.

A molecule binds and blocks a potassium channel in a plant cell membrane. What would be its effects?

Potassium uptake would be blocked because the proton pump would no longer work.

Potassium uptake would be unchanged since potassium readily crosses through the cell membrane's lipid bilayer.

Potassium uptake would be blocked since potassium ions enter cells through facilitated diffusion.

Potassium uptake would be unchanged since uptake is by active transport by pumps. 2. What nutritional benefits can insects provide to carnivorous plants? The carnivorous plant Nepenthes bicalcarata ("fanged pitcher plant") has a unique relationship with a species of ant − Camponotus schmitzi ("diving ant"). The diving ants are not digested by the pitcher plants, but instead live on the plants and consume nectar. Diving ants also dive into the digestive juices in the pitcher, swim to the bottom, and capture and consume trapped insects, leaving uneaten body parts and ant feces behind. What nutritional impact do the ants have on fanged pitcher plants? Do the pitcher plants derive any nutritional benefit from this relationship? Part A Researchers tested the hypothesis that the relationship between diving ants and pitcher plants is mutualistic (i.e., both species derive a nutritional benefit). To do so, they compared leaf surface area (as a measure of overall growth) in two sets of pitcher plants: plants with diving ants and plants without. The results are shown in the graph. The P values indicate whether or not there is a significant relationship between the size of the host plants and the surface area of the host plants' leaves. Based on this graph, what conclusions can be drawn about the impact of diving ants on overall plant growth? Source: Bazile, V. et al. 2012. PLoS ONE 7: e36179. the terms on the left to the appropriate blanks on the right to complete the sentence positive negative with without Plants ______ diving ants show significantly larger total leaf surface area than plants ants. Plants ________ ants grow taller without any significant increase in leaf surface area. In plants ______ ants, however, leaf surface increases significantly as the plants grow taller. Therefore, diving ants have a ______ impact on overall plant growth. Please answer all four blanks from above options.

The loading buffer's stock concentration is 10X. For a 20 µl PCR sample in need of loading into a gel, the loading buffer works best: a) a 1 X B) when 2 µl of the 10 X is pipetted into the 20 µl PCR sample C) Neither of the above

TRUE OR FALSE: EtBr does not stain any of the reagents that are pipetted into a microcentrifuge tube for a PCR reaction

Which of the following are characteristics of fungi?

Cells lack a nucleus

Are heterotrophic

Are Autrophic

Cells lack Chlorplasts

1. Which type of ecologist is most interested in processes that connect

different ecosystems within a geographic region?

A) an organismal ecologist

B) a community ecologist

C) a landscape ecologist

D) a paleoecologist

2. The distribution of a species, i.e., where it is present or absent, can be

influenced by:

A) abiotic environmental factors

B) its ability to disperse

C) interactions with other species

D) all of the above

3. Rank the following biomes from most productive/species rich (1) to least

productive/species rich (4):

___ tundra

___ temperate grassland

___ tropical rainforest

___ desert

4. Which equation best describes a population over time when resources

are not limiting growth at all?

A) N

new

= N

old

+ r*N

old

– lf

B) N

new

= N

old

+ r*N

old

(K – Nold)

K

C) N

new

= N

old

+ r*N

old

D) G = (B + I) – (D + E)

The first step that leads to the evolution of the seed plant life cycle was likely:

The pollen of seed-bearing plants and the spores of seedless vascular plants are both transported by air. How do these structures differ?

5. During the isometric contraction phase of the cardiac cycle,

A both mitral and aortic valves are open.

B the mitral valve is open but the aortic valve is closed.

C the mitral valve is closed but the aortic valve is open.

D both mitral and aortic valves are closed.

22) Percardial effusion is most likely to directly impede the filling of the
a) left ventricle b)left atrium c) right atrium d) right ventricle
23) ------- is a common cause of aortic stenosis
a) inflammatory damage b)congenital malformation c) calcification d)all of the above
27) The movement of blood into and out of the lungs is called
a) perfusion b)ventilation c)diffusion active transport
31) ----- is reduced oxygenation of arterial blood by respiratory alterations
a) ischemia b)hypoxia c)hypoxemia d) hypocapnia
33) ------ asthma is less common and it's etiology is unknown
a) extrinsic b)intrinsic c) atopic d)allllergic
34) it has been suggested that-----asthma may be caused by environmental antigens
a) extrinsic b)intrinsic c) nonatopic d b and c e)a,b and c
36) individuals with emphysema usually present with
a) productive cough b)obesity c) dyspnea on exertion d) none of the above
37) A pulmonary embolism may lead to
a) shock b) pulmonary infarction c) pulmonary hypertension d)a and b e) a,b,and c

20) cardiac arrhythmia may be causes by all of the following except
a) ischemia b) hypoxia c) automatic nervous system imbalance d) abnormalities in potassium levels e) none of the above are exceptions
22) Percardial effusion is most likely to directly impede the filling of the
a) left ventricle b)left atrium c) right atrium d) right ventricle
23) ------- is a common cause of aortic stenosis
a) inflammatory damage b)congenital malformation c) calcification d)all of the above
27) The movement of blood into and out of the lungs is called
a) perfusion b)ventilation c)diffusion active transport
31) ----- is reduced oxygenation of arterial blood by respiratory alterations
a) ischemia b)hypoxia c)hypoxemia d) hypocapnia
33) ------ asthma is less common and it's etiology is unknown
a) extrinsic b)intrinsic c) atopic d)allllergic
34) it has been suggested that-----asthma may be caused by environmental antigens
a) extrinsic b)intrinsic c) nonatopic d b and c e)a,b and c
36) individuals with emphysema usually present with
a) productive cough b)obesity c) dyspnea on exertion d) none of the above
37) A pulmonary embolism may lead to
a) shock b) pulmonary infarction c) pulmonary hypertension d)a and b e) a,b,and c

True or False? Ischemia leads to hypoxia, but hypoxia can occur with no evidence of ischemia.

Which of the following has a strong, positive inotropic effect, meaning it increases the strength of each contraction of the heart?

Myocardial hypercapnia

Hypocalcemia

Hyperkalemia

Hypercalcemia

Myocardial hypoxia

which of the following cause pulmonary vasoconstriction?
a. hypercapnia
b. hypoxia
c academia
d.increase H+ concentration

9.Rhythmicity of breathing involves: a.conscious effort andcontrol. b.stimulation of inspiration. Expiration is automatic. c.integration of stimuli that start and then stop inspiration. d.aset pattern of inspiration - expiration that is always the same.e.regulation of stimuli that start inspiration and stopexpiration.

Why does inspiration require energy?

A rise in blood glucose promotes …

The experiment shown in Figure 12.10 was done using cytoplasm. What could the investigators do to determine whether the regulatory molecule was present in the cytosol or in a cytoplasmic organelle?

A- Use radioactive isotope labeling to separate the organelles and cytosol from M-phase cells and microinject only the organelles into the frog oocytes

8. With an increase in contractility of the left ventricle, all of the following left-ventricular parameters will increase EXCEPT

A end systolic volume.

B peak systolic pressure.

C rate of pressure increase (i.e., dP/dt) during systole.

D stroke volume.

All of the following are types of lysosomal storage disorders, EXCEPT:

Tay-Sachs Disease

Danon Disease

Galactosialidosis

Hunter Syndrome

Kartagener Syndrome

Krabbe Disease

Please help to check if the following DNA repair description is correct. if not, please help to correct. thanks!!

1. Base Excision Repair

DNA plycosylase comes in and removes deaminated C Uracil. AP endonuclease recognizes the missing tooth created by DNA glysosylase and it removes the sugar while phosphodiesterase removes phosphate group leaving DNA helix with single nucleotide gap. DNA polymerase add new nucleotide and DNA ligase seals the nick

2. Nucleotide Excision Repair

NER uses to remove large mutation. Excision nuclease comes in and cut the pyrimidine primers in a big chunk. DNA helicase removes the big chunk. DNA polymeraze synthesize nucleotides and DNA ligase seals the nick.

3. Nonhomologous end joining

The overhangs ends is recognized by Ku heterodimers and they attach to the broken chromosomes end. Additional proteins attach and join covalently. Overhangs are then digested and ligase seals the nicks

4. The repair involves sister chromatids. One of the sister chromatids has double strand breaks. Exonuclease activity degrades the 5’ end. The strand invasion begins by crossing over. The single strand interacts with healthy strand on sister chromatid DNA molecule. DNA polymerase synthesize missing nucleotides and ligase seals the nicks

The uvrC gene encodes one of the proteins in E. coli nucleotide excision repair. When extracts of E. coli are incubated with the DNA fragment shown below, the mutation shown will be repaired. Note: The ‘T=T’ represents a thymine dimer, while the ‘A.A’ is the undamaged strand (the ‘.’ is just for proper spacing of the rest of the strand). 5'GTAACTATGATGGATAGACCGACAGGGGGACCAGTTG(T=T)GCGGGAGAGACCTTTAGATGAC3’ 3'CATTGATACTACCTATCTGGCTGTCCCCCTGGTCAAC(A.A)CGCCCTCTCTGGAAATCTACTG 5’

a. If an extract was used in which the uvrC protein could only cut the DNA on the 5’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

b. If an extract was used in which the uvrC protein could only cut the DNA on the 3’ side of the lesion, speculate on whether the DNA fragment could still be repaired.

It is to my understanding that in the case of nucleotide excision repair that an uvrA uvrB complex identifies and isolates a problematic "bulky lesion". The complex recruits uvrC which cuts on either side of the damaged area approximately 5-8 nucleotides away. uvrD then is recruited to remove the cut strand. Given this question I assume that if you had a modified uvrC that could either only cut on the 5' or 3' end the segemnt including the damaged area could not be removed by uvrD in both cases meaning ultimately DNA polymerase/Ligase could not come in and fix things which means the segment could not be repaired. Am I correct in my thinking, or is there something I'm missing?

If a mismatched base is not corrected directly by DNApolymerase, which of the following would be used to correct a point mutation?

Patient with Xerodermapigmentosum experience increased frequency of skin cancer. This isdue to a defect in the nucleotide excision repair (NER) pathway.This pathway involves the removal of UV damaged nucleotides withnucleases and the removed sequence is then filled in by DNApolymerase. Compare/contrast this process with DNAproofreading.

a) they are likely to occur in difference phases of the cellcycle
b) only one involves the breaking of phosphodiester bonds
c) if the nuclease activity is from DNA polymerase, one is likelyto involve 5' to 3' nuclease activity while the other involves the3' to 5' activity
d) one likely involves an exonuclease while the other anendonuclease

Which of the following statements regarding Nucleotide Excision Repair (NER) and Base Excision Repair (BER) is true?.

A mutation that changes the codon UAU to the codon UAC in a mammalian cell line is called:

Which of the following metals can participate in the DNA polymerase catalysis (a) Potassium (b) Sodium (c) Calcium (d) Magnesium (e) Selenium

What is DNA gyrase? a. a bacterial Topoisomerase I b. b. a bacterial Topoisomerase II c. a bacterial helicase d. all of the above e. none of the above

The biochemistry of RNA synthesis in prokaryotes and eukaryotes is a. very different b. b. similar but more complicated in prokaryotes c. exactly the same d. similar but more complicated in eukaryotes e. none of the above

In base excision repair, which enzyme(s) cleave(s) the glycosidic bond of the altered nucleotide? (a) DNA glycosylase (b) AP endonuclease (c) DNA polymerase (d) DNA ligase

Assume that an Ames test is performed on an unknown compound. PlateA receives distilled water and rat liver enzymes. The compoundunder test is placed in plate B. Plate C receives the compoundunder test and rat liver enzymes. The next morning plate A has onlyone or two colonies, plate B has many colonies, and plate C hasmany colonies. The best interpretation is:
(explain answer)

A. rat liver enzymes are mutagenic
B. the compound being tested is mutagenic
C. only auxotrophic colonies can grow on the test plates
D. the compound being tested is not mutagenic, but can be convertedto mutagenic compounds by the rat liver enzymes
E. the compound being tested is mutagenic but the rat liver enzymesdestroyed the mutagens

1) A mutation that changes a codon sequence, and subsequentlychanges the amino acid that should have been placed at that pointin the polypeptide chain, is called a

A. frameshift mutation.

B. missense mutation.

C. silent mutation.

D. nonsense mutation.

2) A mutation that changes a codon that originally coded for anamino acid into a stop codon is called a

A. frameshift mutation.

B. missense mutation.

C. silent mutation.

D. nonsense mutation.

3) Assume that a new low-calorie sweetener is developed. Thestructure is novel and is tested with the Ames test formutagenicity. The following results are obtained:

Sample Number of his+ revertant colonies

distilled water 2

distilled water + rat liver enzymes 3

Sweetener 1

sweetener + rat liver enzymes 805

What conclusion is most consistent with this data?

A. The sweetener is not mutagenic.

B. Rat liver enzymes are highly mutagenic.

C. The sweetener is not mutagenic but can be converted intostrong mutagens.

D. The sweetener is mutagenic and can be converted into strongmutagens.

E. The sweetener and its conversion products are equallymutagenic.

4) What protein makes Okazaki fragments?

A. primase.

B. helicase.

C. DNA polymerase III.

D. DNA polymerase I.

E. ligase.

5) In the modification of eukaryotic mRNA, a "cap" consisting ofa/an _________ and a tail consisting of _______ are usually addedto the transcript.

A. acetyl group; multiple cytosines

B. multiple guanines; methyl group

C. multiple thymines; acetyl group

D. methyl group; multiple adenines

6). RNA polymerase binds to a sequence called a/an______________ before beginning transcription.

A. promoter

B. operator

C. structural gene

D. replication origin

7) In Sanger (enzymatic extension) sequencing, what causes DNAsynthesis to terminate at a specific base?

A. chemicals that cleave DNA after particular bases

B. fluorescent chemicals

C. nucleotide triphosphates that lack a base

D. nucleotide triphosphates that lack a hydroxyl

E. nucleosides that lack a 5' phosphate

8) What are differences between chromosomes of most prokaryotesand those of eukaryotes?

A) The prokaryotic chromosome is linear, while the eukaryoticchromosome is circular.

B) The prokaryotic chromosome is circular, while the eukaryoticchromosome is linear.

C) The prokaryotic chromosome has one origin of replication,while eukaryotic chromosomes have several.

D) The prokaryotic chromosome does not have nucleosomes, whilethe eukaryotic chromosome does.

E) The prokaryotic chromosome is not necessary for theorganism's survival, while the eukaryotic chromosome is.

9) As helicase unwinds the DNA molecule, what keeps the strandsapart?

A) DNA polymerase

B) Reverse transcriptase

C) Replication fork

D) Single-strand binding proteins

E) Okazaki fragments

10) Which enzymes are responsible removal of the RNA primers andreplacement with DNA nucleotides and repairing the single-strandednick adjacent to Okazaki?

A) DNA primase

B) DNA polymerase I

C) DNA polymerase III

D) DNA ligase

E) DNA polymerase II

11) Which enzyme activity is associated with the proofreadingmechanism of DNA polymerase I?

A) 5'-to-3' exonuclease activity

B) 3'-to-5' exonuclease activity

C) 5'-to-3' polymerase activity

D) 3'-to-5' polymerase activity

12) Which type of RNA is found only in eukaryotes?

A) mRNA

B) tRNA

C) rRNA

D) snRNA

13) During transcription, the synthesis of the mRNA strandproceeds in which direction?

A) 5' to 3' only

B) 3' to 5' only

C) Both 5' to 3' and 3' to 5'

D) Either 5' to 3' or 3' to 5'

E) First 5' to 3', and then 3' to 5'

14) Which of the following are true?

A) Prokaryotes have only one kind of RNA polymerase, but severaldifferent sigma factors

B) Prokaryotic messages are polycistronic.

C) In eukaryotes, small ribosomal subunit binds to 5%u2019methylated cap and migrates to AUG start codon.

D) In eukaryotes, the mRNA can only be translated by oneribosome at a time.

E) Exons are spliced out of prokaryotic mRNAs

F) Initiating tRNA in prokaryotes is fMet.

G) Eukaryotes, nuclear membrane prevents coupling oftranscription and translation.

H) In eukaryotes, translation continues until the ribosomeencounters the poly-A tail.

15) Every amino acid contains

A) an amino group

B) an acetyl group.

C) a hydroxyl group

D) a carboxyl group

E) an R group

16) What is the role of tRNA in translation?

A) It brings together two subunits of a ribosome.

B) It couples an amino acid with aminoacyl-tRNA synthetase.

C) It helps fold up the finished polypeptide chain.

D) It catalyzes peptidyl transferase activity.

E) It binds to an mRNA codon and carries the corresponding aminoacid

17) But the following steps of translation in prokaryotes inorder:

_____ Termination of translation is signaled by one of threestop codons

_____ An Aminoacyl-tRNA binds to the ribosome in the A site

_____ The small subunit binds to the Shine-Dalgarno sequence

_____ The ribosome moves along the mRNA one codon toward the3%u2019 end

_____ The small subunit of migrates to the region of the mRNAcontaining AUG codon

_____ The large subunit binds to the small subunit

_____ A peptide bond is formed between the amino acids in the Pand A sites

_____ A special initiator tRNA binds to the AUG

1. What molecule is directly produced by the calvin cycle?

!. acetyl CoA

B. glyceraldehyde 3 phosphate

C. ribulose 1,5 bisposphate

D. pyruvate

E. lactose

2. Match the follwoing enzymes of molecules with the appropriate process in which they function.

post-transcriptional modifications, eukaryotic transcription, prokaryotic transcription, replication

given:

sigma factor

ligase

primase (specific RNA polymerase)

transcription factors

spliceosome

3. What prokaryotic enzyme will remove the primer in prokaryotes?

A. RNA polymerase

B. DNA polymerase III

C. DNA polymerase I

D. Topoisomerase (gyrase)

4. Fill in the blanks: _____ is the start codon and _____ is an example of a stop codon.

A. AUG; UUU

B. AUG; UAA

C. AUG; CAA

D. UAA; AUG

Which of the following enzymes unwinds DNA for RNA synthesis? (a) DNA polymerase I (b) DNA polymerase III (c) Helicase (d) RNA polymerase (e) both ‘a’ and ‘b’

The RNA primer pieces are removed by (a) DNA polymerase I (b) DNA polymerase II (c) DNA polymerase III. (d) ribonuclease. (e) none of the above.

An enzyme that can introduce negative supercoils in prokaryotic DNA is (a)Type II Topoisomerase (b) Type I Topoisomerase (c) DNA gyrase (d) both a and c (e) both b and c

What is the process used to remove introns from eukaryotic genes? (a) splicing (b) modification (c) cellular nucleases (d) methylation (e) none of the above

14. What biomolecule delivers the aminoacyl-tRNA to the “A site” of the E. coli ribosome? A. elongation factor-G B. initiation factor-1 C. elongation factor-Ts D. initiation factor-3 E. elongation factor-Tu

What is DNA gyrase?

16.

What type of topoisomerase can introduce supercoils?

17.

What sequence allows bacterial ribosomes to identify the CORRECT AUG start codon?

hat name is given to the region of RNA synthesis that contains the DNA, RNA, and RNA polymerase?

19.

What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100-kd protein?

20.

What is the direction of translation of mRNA?

Which of the following pairs of translation factors exhibit the same enzymatic activity?

A. IF-2/EF-Ts

B. IF-1/EF-Tu

C. IF-2/EF-Tu

D. IF-1/EF-Ts

E. IF-3/EF-Tu

1. Indicate the function of the following translation factors:

eIF

eIF2

eIF3

EFTu

Ef-Ts

EF-G

Release Factors

15. A 37-year-old man becomes acutely ill with fever, chills, nausea, and a painful stiff neck. Suspecting meningitis, the physician orders a lumbar puncture, which contains many white blood cells and organisms. Which of the following is the most common causative agent of bacterial meningitis in adults?

a. Haemophilus influenzae

b. Listeria monocytogenes

c. group B Streptococcus

d. Escherichia coli

e. Streptococcus pneumoniae

16. Angiography in a 64-year-old woman reveals a laterally expanding lesion within the cavernous sinus. Further tests confirm that this lesion is an aneurysm of the internal carotid artery. Which of the following is affected first by this expanding lesion owing to its approximation to the internal carotid artery?

a. The maxillary nerve

b. The trochlear nerve

c. The mandibular nerve

d. The oculomotor nerve

e. The abducens nerve

17. A 32-year-old woman becomes acutely ill with fever, pain in the orbits, and diplopia. The neurologist discovers that she has a severe maxillary sinus infection that has spread into her nose and onto the face. The examining physician concludes that this patient has a venous thrombosis. Based on their location and venous connection, which of the following is the most likely venous structure involved in this patient?

a. Straight sinus

b. Transverse sinus

c. Vein of Labbé

d. Cavernous sinus

e. Superior sagittal sinus

18. The caudal end of the spinal cord (conus medullaris) is anchored to the inner aspect of the spinal dural sac by which of the following?

a. Filum terminale externum

b. Filum terminale internum

c. Coccygeal ligament

d. Denticulate ligament

e. Arachnoid trabeculae

A 47-year-old man complains of slowly progressing weakness of both “legs.” On examination he has a flaccid paralysis of both lower extremities, muscle fasciculations, hypotonia, and areflexia. In addition, there is loss of pain and temperature sensations over the anterior aspect of both lower extremities and most of the feet but sparing the little toes.

19. The flaccid paralysis, fasciculations, hypotonia, and areflexia in this patient are most likely the result of damage to what structures?

a. Lateral corticospinal tracts

b. Posterior (dorsal) roots

c. Anterior (ventral) horn cells and alpha motor neurons

d. Reticulospinal/vestibulospinal tracts

e. Afferent fibers involved in monosynaptic reflexes

20. The MRI of a 69-year-old woman reveals a tumor in the posterior fossa resulting in significant compression of the medulla. Which of the following deficits could appear suddenly in this patient and would signal potential medullary failure?

a. Agnosia

b. Paralysis of the lower extremities

c. Complete loss of pain and thermal sense from the body

d. Central apnea

e.Blindness