Filter By
Filter Reset
Exam Types
  • All Exams
  • Final (3)
Semester
Study Guides (298,867)
AUS (8,325)
UTS (233)
91132 (3)

Study Guides for 91132 at University of Technology Sydney

Mental Health and Chinese Medicine

91132 Study Guide - Final Guide: Alternative Splicing, Tata Box, Start Codon

ATGCTCAACTCTGACTCTGTTTGTCTCAGTAG The consequence of this mutation would be a change in the codons downstream from the mutation. DNA has the structure of double-stranded. These molecules have the following important propert...

Science
91132
All Professors
91132 Final: Molecular Biology

Molecular Biology 8192013 5:11:00 AM Lecture 1 DNA Review Gene Expression The miracle of water lets us use a molecule that can do a abundant of functions. Due to the unique dipolarity of water, it has the ability to form s...

Science
91132
All Professors
91132 Study Guide - Final Guide: Hydrophile, Ethanol Precipitation, Relative Permittivity

Ethanol precipitation of DNA with salts Theory. Prepared by Ms Alex Aitken The purpose of adding salts is to neutralize the charge on the sugarphosphate backbone of the DNA. Ethanols task is a little more complex than rem...

Science
91132
All Professors
Get Study Guides for 91132 at University of Technology Sydney

We are currently building a library of Study Guides for 91132 at University of Technology Sydney. Request and we’ll let you know once it’s available.

Thank you! We have received your request.

Log In


OR

Don't have an account?

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit