Study Guides (238,408)
Canada (115,131)
Biology (3)
BIOL 326 (2)
carly (2)


4 Pages
Unlock Document

Humber College
BIOL 326

Exam questions from an Introductory Microbiology course 1. All of the following are matching pairs EXCEPT… A. biosynthesis - anabolism B. energy released - exergonic C. oxidation - loss of electrons D. oxidation - loss of hydrogen E. NAD +- reducing power 2. You are working with a pharmaceutical company interested in developing an antibacterial drug that targets a transport protein. Interfering with which group of transporters is most likely to affect the bacterium without harming the patient? A. facilitiffusion B. acttansport C. grtranslocation 3. Two bacterial isolates have significant difference in the nucleotide sequences of their 16S ribosomal RNA genes. Based on this information, you can conclude that… A. only one is susceptible to antibiotics that target the ribosome. B. one has 80S ribosome and the other has 70S ribosomes. C. one has a 30S ribosomal subunit and the other has a 50S ribosomal subunit. D. they aren't members of the same species. E. one is a rod and the other a coccus. 4. A bacterial cell moving towards which of the following is an example of chemotaxis? Am.agnet B. a warm heating element C. a cold heating element D. glucose 5. Which fermentation end product is responsible for the tart taste of yogurt and sour cream? A. CO 2 B. pyruacidc C. laacidc D. ethanol E. A and D 6. Which of the following statements is TRUE? A. To avoid Staph. food poisoning, ham should be heated immediately before it is consumed. B. To avoid Staph. food poisoning, home canned green beans should be heated immediately before they are consumed. C. To avoid botulism, ham should be heated immediately before it is consumed. D. To avoid botulism poisoning, home canned green beans should be heated immediately before they are consumed. E. A and B are both true. Questions from an Introductory Genetics class 7. Based on the sequence of mRNA below, where did transcription start? (the letter indicates the position on the template strand) 3UACGACUAAUAGGCGCAUCCUCGAUC 5' A C → ← B D 1. Below are two DNA coding strand sequences. The 5’ ATG encodes the start codon. Tom’s coding DNA sequence is: 5’ ATG CGC TTA CCC TTA CTC CTA TAA3’ Harry’s coding DNA sequence is: 5’ ATG CGC TAA CCC TTA CTC CTA TAA 3’ Harry’s mutation causes the premature termination of: A. Replication B. Transcription C. Translation D. Answer B and C E. All of the above 2. A geneticist isolates a g
More Less

Related notes for BIOL 326

Log In


Don't have an account?

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.