Study Guides (238,415)
Canada (115,127)
BIOL 112 (23)

Sample Questions Chapters 9-12

5 Pages
Unlock Document

McGill University
Biology (Sci)
BIOL 112
Joseph Dent

Sample Questions, Lectures 9-12 1) Examples of transposable elements include: a) Retrotransposons b) Alu elements c) Telomeres d) a and b e) b and c 2) To move around the genome, retrotransposons require: a) Transposase b) Reverse transcriptase c) Telomerase d) Primase e) None of the above 3) If telomerase is inactivated: a) Chromosomes become shorter with every cell division b) Telomeres become longer with every cell division c) Introns will not be spliced d) Transposons become longer with every cells division e) None of the above 4) mRNA processing includes: a) Transcription b) Translation c) Addition of a poly A tail d) a and b e) a and c 5) If a pre-mRNA has the exons 5' A^B^C^D^E 3' (where ^ represents and intron), alternative splicing might produce an mRNA with the exons: a) 5' ABC 3' b) 5' AABCDE 3' c) 5' ABDCE 3' d) 5' ABCBA 3' e) none of the above 6) If I put a eukaryotic gene in a prokaryotic cell, the protein it encodes will not be expressed if: a) The eukaryotic gene has a termination codon. b) The eukaryotic gene has introns. c) The eukaryotic gene has a wobble base. d) The eukaryotic gene has a start codon. e) All of the above 7) TFIID binds: a) Enhancers b) Promoters c) TATA box d) a and b e) b and c 8) A triplo-X female (XXX) will have: a) 1 Barr body b) 2 Barr bodies c) 3 Barr bodies d) a or b e) none of the above 9) Degradation of Cyclin D at the end of G1 is an example of: a) Transcriptional regulation b) Alternative splicing c) Translational control d) Posttranslational control e) All of the above 10)The heat shock factor (HSF) is a transcription factor that binds to an enhancer element that is present in front of three genes, hspA, hspB and hspC that are transcriptionally activated by heat shock. If I delete the enhancer element in front of hspA and heat shock the cell: a) HSF will not be transcribed b) hspA will not be transcribed c) hspB will not be transcribed d) hspC will not be transcribed e) All of the above 11)The restriction enzyme Hha I cuts the restriction site 5' GCGC 3'. If I cut the double stranded DNA fragment with the sequence: 5' ATGCGCGTTAAGCGAGCGCTTA 3' with Hha I, how many DNA fragments will result? a) 1 b) 2 c) 3 d) 4 e) 5 12)The restriction enzyme Spe I cuts the restriction site 5' ACTAGT 3' at the phosphodiester bond between the A and the C. Xba I cuts the restriction site 5' TCTAGA 3' at the TC phosphodiester bond. If I cut my gene with Spe I and my plasmid with Xba I and ligate the fragments toget
More Less

Related notes for BIOL 112

Log In


Don't have an account?

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.