BIOL 330 Study Guide - Final Guide: Secretion, Hydrolase, Endoplasmic Reticulum

60 views5 pages

browngoose276

7 Mar 2016

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Levels of regulation: chromatin structure, remodeling, open, close, histones, acetylation, de-acetylation, activators, repressors, transcription, activators, repressors c, dimerization, affinity to dna (ligand dependent/ phosphorylation dependent) Location: repressor, activator, rna processing (changing the levels of rna and proteins, splicing (alternitive splicing, poly a tail c. Sensitivity to endo (inside) and exonucleases (outside: rna degradation, translation, protein modification, protein degradation, ubiquitin ligase. Transcription (activators and repressors, that work to regulate or modify the level of transcription) Chromatin remodeling complex (responsible for opening up certain parts of genome in response to changes in histone. Methylation of histones to close up dna. General transcription factors (attract rna polymerase, don"t provide specificity) Specific transcription factors, helicase, and chromatin remodeling process, Exonuclease that chews back on poly a tail (non-specific) Endonuclease has sequence specificity that cuts mrna in a specific spot. Ribosomes (50 proteins, 2 parts; top and bottom part and. Rna"s in there to give specificity and give shape)

Related Questions

Place the following steps of DNA replication in right chronological order.
1. Primase adds an ribonucleotide primer
2. Initiator proteins bind the origin of replication and helicase breaks hydrogen bonds between complementary bases of double stranded template DNA
3. DNA polymerase III extends by complementary base pairing deoxyribonucleotides to the template strands
4. Ligase phosphodiester bonds the nucleotides to connect okazaki fragments nad connect fragments at the origin and where the "crotches or forks" collide
5. DNA polymerase I removes RNA primer and replaces with Deoxyribonucleotides

plumsardine151

1) What is the difference between the leading strand and the lagging strand in DNA replication? Place the following steps of DNA replication in right chronological order.

1. Primase adds an ribonucleotide primer
2. Initiator proteins bind the origin of replication and helicase breaks hydrogen bonds between complementary bases of double stranded template DNA
3. DNA polymerase III extends by complementary base pairing deoxyribonucleotides to the template strands
4. Ligase phosphodiester bonds the nucleotides to connect okazaki fragments nad connect fragments at the origin and where the "crotches or forks" collide
5. DNA polymerase I removes RNA primer and replaces with Deoxyribonucleotides

2) Given the template DNA and primer sequences below, what bases will be added to the primer as DNA replication proceeds? (The bases should appear in the order that they will be added)

5'-GTCGTCTCCCTTTTTAAAAACCCCCCC-3'
5'-UUUUUAAAAAGGG-3'

3) Given the DNA sequence below, what could be a primer sequence used in its replication?
5'-CGTACGGCCCCAAAATTGCTACTCTGCTG-3'

raspberryleopard304

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 330 Study Guide - Final Guide: Secretion, Hydrolase, Endoplasmic Reticulum

Document Summary

Get access

Related Documents

BIOL 330 Study Guide - Final Guide: Rna Polymerase Ii, Rna Polymerase I, Northern Blot

Related Questions