[CHEM 121] - Final Exam Guide - Comprehensive Notes fot the exam (81 pages long!)

Study Guide for Exam 2 Chapter 3: Molecules, Compounds, and Chemical Equations Sections: 3.2-3.11 Important Questions and Concepts: . What are ionic and covalent bonds? . How do we represent compounds? What is the difference between a molecular formula and an empirical formula? What is a structural formula? How do we show the 3D structure of a molecule? What is the difference between an element, molecular element, ionic compound, and molecular compound? How do we write the chemical formula for ionic compounds? What is the naming scheme for ionic compounds? What is the naming scheme for molecular compounds including acids? molar mass of a compound? . What is the formula mass of a compound? How is it related to the How do we calculate the mass percent of elements in a compound? . What are the steps when calculating an empirical formula? What q tities are needed and in what units? . How is the empirical formula related to the molecular formula? chemical equation be balanced? Additional Practice Problems: 23, 30, 31, 33-46, 47-54, 63, 69, 79, 81, 85, 89, 91, 101, 102, 119, and 121 & Challenge Problems: 143 and 151

Stadent An Introduction to the Chemical Basis of Life Thiere ave ninety-two naturally occurring elements in the universe. An element is a substance that canniot he separated into simpler substances by purely chemical means The smallest indivisible unit of an element is the atom is composed of three fundamental particles, protons s and electrons Protons are positively charged particles and along with neutrons, which not have any electrical change and are therefore n neutron cutral. are found in the nucleus of the atom Electrons are negatively charged particles that occupy specific orbits around the nucleus t with cach to form discrete units called molecules The atoms of a molecule can te kind or different kinds; that is, they can be the same or different clements be the sa Molecules containing atoms of two or more known as compounds different elements in specific proportions are Objective: Review and practice chemical concepts introduced in your lecture Using your lecture notes, textbook and the periodic table provided 1. Worksheet: identify in one or two sentences the following concepts related to the periodic table: Family or Group · Period Mctal Transition Element Non-metal . Inert gases Valencoe Electronegativity

CHEM 151 Fall 2016 Final Exam Review Chapter 8, Chapter 9.1 1. Explain why, RNA, and not DNA, is hydrolyzed under basic pH conditions. Draw a mechanism to explain your reasoning. 2. A strand of DNA has the following sequence: S TCGTTTACGATCCCCATTTCGTACTCGA 3 a) What is the sequence of its complementary strand? b) What is the base sequence of mRNA transcribed from the first strand? 3. Hand-draw out the DNA sequence AGTC and its complement including sugars and phosphate backbone. Show the hydrogen-bonding between the base pairs and label the directionality of each strand 4. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoRI SATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 5. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme BamHI S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3" 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 6. Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme Kpnl and Hind III S'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAACS 7. Describe why a double-stranded DNA with a high G-C content has a higher Tm than a double-stranded DNA with a high A-T content. 8. A Sanger dideoxy sequence analysis was performed on wild type and a mutant gene. The sequencing gels are represented below. From these results