BPS 3101 Study Guide - Midterm Guide: Southern Blot, Bamhi, Oligomer

93 views3 pages

Document Summary

Tip: if you have multiple candidates, you can prioritize them (eg. longer ones would rank higher than shorter ones ). Suppose you have analyzed a section of the bacterial x genome and find a bidirectional promoter within the position of the box. (the region within the box contains 150 bp which are not shown). Show its/their location(s) and label any important features. Give the amino acid sequences for any proteins potentially encoded at this genomic location. Suppose that a region of the mouse genome contains gene a (exons = black blocks), gene b (exons=grey blocks) and gene c (exons=white blocks) as shown in the figure below. Scale : 1 cm = 400 bp. genome containing 5 genes than for a human dna region containing 5 genes. Southern hybridization experiment (when gene x is used as the probe). of genes in organism x. 5" aagctcagagtacgcaatatgaatctagcaaattagagt agcatccgatataaaagctgatgttacccgtagcatttaaggg 3" 3" ttcgagtctcatgcgttatacttagatcgtttaatctca tcgtaggctatattttcgactacaatgggcatcgtaaattccc 5"5" aagctcagagtacgcaatatgaatctagcaaattagagt agcatccgatataaaagctgatgttacccgtagcatttaaggg 3" 3" ttcgagtctcatgcgttatacttagatcgtttaatctca tcgtaggctatattttcgactacaatgggcatcgtaaattccc 5"(i)

Get access

Grade+20% off
$8 USD/m$10 USD/m
Billed $96 USD annually
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
40 Verified Answers

Related Documents

Related Questions