B I O L O G Y 1002B
March 17, 2013 Time: 2 Hours
Student number Room Row
Print Name _______________________________________________ ______
I NSTRUCTIONS - F OLLOW THE CHECK LIST !
(√ ) On your Scantron sheet Fill the bubbles completely
Print name Print clearly
• Use HB pencil only
Signature Do your best • No stray marks or doodles
Instructor Haffie • Make all erasures complete
Course Bio 1002B
Student number Print clearly/ Bubble neatly Yes - Calculators are permitted
Exam Code 111 – Very important (non-programmable only)
Section Leave it blank
Answer Sheet Leave it blank No – Borrowing is not allowed
(√ ) On your Test Book
Student number Legibly please
Name Print your name Scantron answers will be emailed to you.
Test Room The room you’re in right now Marks will be posted
Row number We will tell you this to OWL after all tests are finished.
Indicate your answers in the test book. Leave no questions blank.
1) Please place your ID prominently on your desk and sign th4) Indicate your answers in both the test paper and on the
attendance sheet when it comes to you. Scantron.
2) There are 11 pages in this test. Check your paper careful5). It is your responsibility to transfer all answers from the test
book to the Scantron sheet within the 2 hour test period.
3) There is only one fully correct answer for each question. Part
marks may be awarded. Answer all questions. We do not 6) When finished, please stay seated and raise your hand.
subtract wrong from right. We will collect both your test book and Scantron sheet.
The Scantron marking program has a cheating analysis feature that compares answer patterns for all papers.
It alerts us to similarities. We then check seating arrangements.
Warning
Do not sit near your study partners or write the same test codes. Keep your work directly in front of you.
Please help us avoid any and all misunderstandings during these tests
Clarifications :Please defend your arguments on this page only. Comments will not be accepted after the test.
Q # Ans Clarification Alt Ans
40 D If you mean Denis has a dog named Watson, then my answer changes B March 2013 Biology 1002B Page 1 of 11
Circle the best single letter choice for each of the following questions before transferring
your answers to your computer sheet. Note: Questions may have 3, 4 or 5 choices.
1. One of the key transitions in the development of life occurred after the rise in 2 concentration
in the atmosphere.
What was the main source of this O ?2
A. Respiration in archaea and bacteria.
B. Respiration in early eukaryotes.
C. Photosynthesis in bacteria.
D. Photosynthesis in chloroplasts.
2. Membrane surface area and cell volume are two physical variables that are relevant in
explaining the difference in size and complexity between prokaryotic and eukaryotic cells.
Which of the following statements about these variables is correct?
1. The ratio of plasma membrane area to total cell volume increased in early eukaryotes
which allowed for greater morphological complexity.
2. The total membrane area dedicated to oxidative phosphorylation is greater in eukaryotes.
3. Although physically smaller, prokaryotic cells have more to tal cell volume than a typical
eukaryotic cell.
4. In prokaryotic cells, the membrane location of ATP synthase is the same as that for
lactate transport.
A. 1,2 and 3
B. 1 and 3
C. 2 and 4
D. 4 only
E. All of 1,2,3 and 4 are correct
3. Genomes sizes among related eukaryotes vary much more widely than genome sizes among
related bacteria.
How is this difference in variability bes t explained?
A. Evolutionary processes (e.g. natural selection) exert less constraint on genome size in eukaryotes
than in bacteria.
B. Genome size is proportional to energy production - cells that make more ATP have more DNA.
C. Eukaryotes have a much wider range of chromosome number than bacteria.
D. Organisms with greater morphological complexity have larger genomes.
4. Is it true that all known eukaryotes have mitochondria?
A. Yes, but some eukaryotes have mitochondria that do not contain D NA.
B. Yes, but some have only one mitochondrion per cell.
C. No, but all eukaryotes contain mitochondria -derived genes.
D. No, but those that don't contain mitochondria contain chloroplasts instead.
Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 2 of 11
5. Once endosymbiosis was first established, it appears that selection favoured organisms with
smaller organelle genomes over evolutionary time. As a result, modern organelle genomes are
greatly diminished in size relative to those of free -living bacteria.
Which of the following is a likely explana tion for why diminished genome size would have been
favoured?
1. Organelle proteins are smaller, requiring fewer amino acids. Therefore s election has
favoured organisms with fewer tRNA genes in organelles.
2. Proteins that are rapidly damaged by reactive oxygen species (ROS) can be replaced more
efficiently if their genes are located in the nucleus. Therefore, selection has favoured
organisms where these genes have transferred out of the organelles into the nucleus.
3. Organelles have typical prokaryotic gene structure. Therefore, selection has favoured
organisms in which organelle genes have lost their introns.
4. Following endosymbiosis, several genes would have been present in both the o rganelle and
nuclear genomes. Theref ore, selection has favoured organisms that lost the organelle copy
of such redundant genes .
A. 1,2 and 3
B. 1 and 3
C. 2 and 4
D. 4 only
E. All of 1,2,3 and 4 are correct
6. Human mitochondria l genomes code for 37 genes but mitochondria produce only 13 proteins.
What would most likely account for mitochondria l genomes having more genes than needed to
code for the proteins produced?
A. Several genes code for products that are not translated .
B. Several genes have been inactivated over evol utionary time and no longer code for proteins.
C. Several genes, and the proteins they code for, are of viral origin. They are not human
mitochondrial genes .
D. Several genes are coded on both the top and bottom strands of DNA. Therefore they code fo r
the same proteins.
7. Which of the following sequences in template DNA would likely code for a hairpin transcription
terminator loop?
A. 3’ GCCCAAAGCTAGCTATTTGGGC
B. 3’ GCGCGCGCGCATATATATATAT
C. 3’ ATGCATGCTACGTACGTACGTA
D. 3’ AUGCAUGCUAAUGCAUGCUAA
Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 3 of 11
8. The rps10 gene codes for one of several protein components of the chloroplast ribosome.
This gene is found in the nuclear genome in some flowering plant species but remains in the
chloroplast genome of other species.
If the rps10 gene arrived in the nucleus in its DNA form, it contained several associated signals
related to its expression. Which of the following signals would have be en present on rps10 and
likely functional in the nuclear/cytoplasmic environment?
1. enhancer
2. promoter
3. SD box
4. start codon
A. 1,2 and 3
B. 1 and 3
C. 2 and 4
D. 4 only
E. All of 1,2,3 and 4 are correct
9. Using the section of the genetic code below, identify the sequence of DNA template that would
code for the polypeptide sequence of Pro-His-Arg.
A. 3’CCACAACGG5’
B. 3’GGTGTGGCT5’
C. 3’GGUGUGGCU5’
D. 3’CCTCATCGT5’
10. Some viruses that infect E. coli produce an “anti-terminator” protein that causes RNA
polymerase to “ignore” the termination signal of one virus gene and con tinue transcribing right
into the next gene.
What might this anti -terminator protein do?
A. Bind to DNA, causing a loop that prevents the RNA polymerase from reaching the termination
signal in DNA.
B. Bind to mRNA to prevent it from complementary base pa iring with itself at the terminator signal.
C. Bind to the termination factor, keeping it away from ribosomes that reach the stop codon.
D. Bind to the polyadenylation signal, preventing the action of the RNAase clipping enzyme.
Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 4 of 11
11.Which of the following features is a characteristic of tRNA anticodons?
1. Are catalytic, making the tRNA a ribozyme.
2. For the codon of 5’UAA, there is a complementary anticodon 3’AUU.
3. Bind to specific amino acids.
4. Can be coded in DNA of mitochondrial genom es.
A. 1,2 and 3
B. 1 and 3
C. 2 and 4
D. 4 only
E. All of 1,2,3 and 4 are correct
12. Although most genes have been lost from mitochondria since the original endosymbiosis was
established, some remain in the mitochondrial genome.
Which of the following genes would you most likely find remaining in modern plant
mitochondria?
A. components of Rubisco
B. cytochrome C
C. snRNA
D. polyA polymerase
E. None, modern plants don’t have mitochondria.
13. Ribosomes are “ribonucloprotein particles ” in that they are composed mostly of rRNA with some
associated ribosomal proteins .
How would the genes coding for ribosomal RNA s be different than the genes coding for
ribosomal proteins?
A. Only the protein coding genes would have transcription termi nation signals.
B. Only the RNA coding genes would have anticodons.
C. Only the protein-coding genes would have polyT sequences giving rise to polyA tails.
D. Only the protein-coding genes could suffer a nonsense mutation.
14. Modern Chlamydomonas cells contain one large chloroplast that requires thousands
of proteins.
Where are these chloroplast proteins translated?
1. On the rough endoplasmic reticulum.
2. Inside the chloroplast.
3. In the nucleus.
4. In the cytoplasm.
A. 1,2 and 3
B. 1 and 3
C. 2 and 4
D. 4 only
E. All of 1,2,3 and 4 are correct
Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 5 of 11
15. This picture of the structure and expression of the lac operon, showing the coding regions of
lacI, Z, Y and A genes, in a different style than you’ve seen before.
If
More
Less
