Study Guides (248,358)
Canada (121,503)
Biology (1,540)
Tom Haffie (147)
Final

Bio 1002B March exam Feedback.pdf

13 Pages
186 Views
Unlock Document

Department
Biology
Course
Biology 1002B
Professor
Tom Haffie
Semester
Winter

Description
B I O L O G Y 1002B March 17, 2013 Time: 2 Hours Student number Room Row Print Name _______________________________________________ ______ I NSTRUCTIONS - F OLLOW THE CHECK LIST ! (√ ) On your Scantron sheet Fill the bubbles completely Print name Print clearly • Use HB pencil only Signature Do your best • No stray marks or doodles Instructor Haffie • Make all erasures complete Course Bio 1002B Student number Print clearly/ Bubble neatly Yes - Calculators are permitted Exam Code 111 – Very important (non-programmable only) Section Leave it blank Answer Sheet Leave it blank No – Borrowing is not allowed (√ ) On your Test Book Student number Legibly please Name Print your name Scantron answers will be emailed to you. Test Room The room you’re in right now Marks will be posted Row number We will tell you this to OWL after all tests are finished. Indicate your answers in the test book. Leave no questions blank. 1) Please place your ID prominently on your desk and sign th4) Indicate your answers in both the test paper and on the attendance sheet when it comes to you. Scantron. 2) There are 11 pages in this test. Check your paper careful5). It is your responsibility to transfer all answers from the test book to the Scantron sheet within the 2 hour test period. 3) There is only one fully correct answer for each question. Part marks may be awarded. Answer all questions. We do not 6) When finished, please stay seated and raise your hand. subtract wrong from right. We will collect both your test book and Scantron sheet. The Scantron marking program has a cheating analysis feature that compares answer patterns for all papers. It alerts us to similarities. We then check seating arrangements. Warning Do not sit near your study partners or write the same test codes. Keep your work directly in front of you. Please help us avoid any and all misunderstandings during these tests Clarifications :Please defend your arguments on this page only. Comments will not be accepted after the test. Q # Ans Clarification Alt Ans 40 D If you mean Denis has a dog named Watson, then my answer changes B March 2013 Biology 1002B Page 1 of 11 Circle the best single letter choice for each of the following questions before transferring your answers to your computer sheet. Note: Questions may have 3, 4 or 5 choices. 1. One of the key transitions in the development of life occurred after the rise in 2 concentration in the atmosphere. What was the main source of this O ?2 A. Respiration in archaea and bacteria. B. Respiration in early eukaryotes. C. Photosynthesis in bacteria. D. Photosynthesis in chloroplasts. 2. Membrane surface area and cell volume are two physical variables that are relevant in explaining the difference in size and complexity between prokaryotic and eukaryotic cells. Which of the following statements about these variables is correct? 1. The ratio of plasma membrane area to total cell volume increased in early eukaryotes which allowed for greater morphological complexity. 2. The total membrane area dedicated to oxidative phosphorylation is greater in eukaryotes. 3. Although physically smaller, prokaryotic cells have more to tal cell volume than a typical eukaryotic cell. 4. In prokaryotic cells, the membrane location of ATP synthase is the same as that for lactate transport. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct 3. Genomes sizes among related eukaryotes vary much more widely than genome sizes among related bacteria. How is this difference in variability bes t explained? A. Evolutionary processes (e.g. natural selection) exert less constraint on genome size in eukaryotes than in bacteria. B. Genome size is proportional to energy production - cells that make more ATP have more DNA. C. Eukaryotes have a much wider range of chromosome number than bacteria. D. Organisms with greater morphological complexity have larger genomes. 4. Is it true that all known eukaryotes have mitochondria? A. Yes, but some eukaryotes have mitochondria that do not contain D NA. B. Yes, but some have only one mitochondrion per cell. C. No, but all eukaryotes contain mitochondria -derived genes. D. No, but those that don't contain mitochondria contain chloroplasts instead. Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 2 of 11 5. Once endosymbiosis was first established, it appears that selection favoured organisms with smaller organelle genomes over evolutionary time. As a result, modern organelle genomes are greatly diminished in size relative to those of free -living bacteria. Which of the following is a likely explana tion for why diminished genome size would have been favoured? 1. Organelle proteins are smaller, requiring fewer amino acids. Therefore s election has favoured organisms with fewer tRNA genes in organelles. 2. Proteins that are rapidly damaged by reactive oxygen species (ROS) can be replaced more efficiently if their genes are located in the nucleus. Therefore, selection has favoured organisms where these genes have transferred out of the organelles into the nucleus. 3. Organelles have typical prokaryotic gene structure. Therefore, selection has favoured organisms in which organelle genes have lost their introns. 4. Following endosymbiosis, several genes would have been present in both the o rganelle and nuclear genomes. Theref ore, selection has favoured organisms that lost the organelle copy of such redundant genes . A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct 6. Human mitochondria l genomes code for 37 genes but mitochondria produce only 13 proteins. What would most likely account for mitochondria l genomes having more genes than needed to code for the proteins produced? A. Several genes code for products that are not translated . B. Several genes have been inactivated over evol utionary time and no longer code for proteins. C. Several genes, and the proteins they code for, are of viral origin. They are not human mitochondrial genes . D. Several genes are coded on both the top and bottom strands of DNA. Therefore they code fo r the same proteins. 7. Which of the following sequences in template DNA would likely code for a hairpin transcription terminator loop? A. 3’ GCCCAAAGCTAGCTATTTGGGC B. 3’ GCGCGCGCGCATATATATATAT C. 3’ ATGCATGCTACGTACGTACGTA D. 3’ AUGCAUGCUAAUGCAUGCUAA Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 3 of 11 8. The rps10 gene codes for one of several protein components of the chloroplast ribosome. This gene is found in the nuclear genome in some flowering plant species but remains in the chloroplast genome of other species. If the rps10 gene arrived in the nucleus in its DNA form, it contained several associated signals related to its expression. Which of the following signals would have be en present on rps10 and likely functional in the nuclear/cytoplasmic environment? 1. enhancer 2. promoter 3. SD box 4. start codon A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct 9. Using the section of the genetic code below, identify the sequence of DNA template that would code for the polypeptide sequence of Pro-His-Arg. A. 3’CCACAACGG5’ B. 3’GGTGTGGCT5’ C. 3’GGUGUGGCU5’ D. 3’CCTCATCGT5’ 10. Some viruses that infect E. coli produce an “anti-terminator” protein that causes RNA polymerase to “ignore” the termination signal of one virus gene and con tinue transcribing right into the next gene. What might this anti -terminator protein do? A. Bind to DNA, causing a loop that prevents the RNA polymerase from reaching the termination signal in DNA. B. Bind to mRNA to prevent it from complementary base pa iring with itself at the terminator signal. C. Bind to the termination factor, keeping it away from ribosomes that reach the stop codon. D. Bind to the polyadenylation signal, preventing the action of the RNAase clipping enzyme. Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 4 of 11 11.Which of the following features is a characteristic of tRNA anticodons? 1. Are catalytic, making the tRNA a ribozyme. 2. For the codon of 5’UAA, there is a complementary anticodon 3’AUU. 3. Bind to specific amino acids. 4. Can be coded in DNA of mitochondrial genom es. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct 12. Although most genes have been lost from mitochondria since the original endosymbiosis was established, some remain in the mitochondrial genome. Which of the following genes would you most likely find remaining in modern plant mitochondria? A. components of Rubisco B. cytochrome C C. snRNA D. polyA polymerase E. None, modern plants don’t have mitochondria. 13. Ribosomes are “ribonucloprotein particles ” in that they are composed mostly of rRNA with some associated ribosomal proteins . How would the genes coding for ribosomal RNA s be different than the genes coding for ribosomal proteins? A. Only the protein coding genes would have transcription termi nation signals. B. Only the RNA coding genes would have anticodons. C. Only the protein-coding genes would have polyT sequences giving rise to polyA tails. D. Only the protein-coding genes could suffer a nonsense mutation. 14. Modern Chlamydomonas cells contain one large chloroplast that requires thousands of proteins. Where are these chloroplast proteins translated? 1. On the rough endoplasmic reticulum. 2. Inside the chloroplast. 3. In the nucleus. 4. In the cytoplasm. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correct Code 111 Code 111 Code 111 March 2013 Biology 1002B Page 5 of 11 15. This picture of the structure and expression of the lac operon, showing the coding regions of lacI, Z, Y and A genes, in a different style than you’ve seen before. If
More Less

Related notes for Biology 1002B

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit