Study Guides (248,679)
Canada (121,689)
York University (10,209)
Economics (643)
ECON 1540 (43)
Midterm

test2-2012.pdf

5 Pages
163 Views

Department
Economics
Course Code
ECON 1540
Professor
Eytan Lasry

This preview shows pages 1 and half of page 2. Sign up to view the full 5 pages of the document.
Description
NAME:_______ANSWERS______ STUDENT #:_______________________ 1 FACULTY OF SCIENCE & ENGINEERING SC/BIOL 3155 3.0 - VIROLOGY MIDTERM TEST #2 (W12) March 15, 201288 INSTRUCTIONS: (1) Fill in your NAME and STUDENT # on ALL 5 pages of this Test booklet & the Scantron Sheet. Pages with no name and std# will not be eligible for remarking. (2) Multiple choice questions have only ONE (1) CORRECT answer. Fill in answer on the Scantron Sheet supplied – only the scantron sheet will be marked. (3) The test is divided into 3 Sections. Section I Multiple choice 10 marks (1 mark per question) Section II Written answers 15 marks Total marks: 25 Section III Bonus question 1 mark (4) Answer ALL questions. (5) No calculators are permitted. (6) Total time: 80 mins (7) Hand in your Entire Test Booklet and Scantron Sheet - missing page(s) or exams not handed in will receive ZERO. GOOD LUCK! NAME:_______ANSWERS______ STUDENT #:_______________________ 2 SECTION I: Answer all questions 1 - 10 in this section on the SCANTRON SHEET (1) Which of the following statements is correct when lambda CII is present at high levels? A. indirectly leads to activation ofLP and PR B. ends up causing the lysis of the bacteria C. directly activates int, PAQ and P R D. binds to PL and P Rperators E. directly activates AQ , Pintnd P RM F. indirectly leads to activation ofRM G. none of the above is a correct answer to the question (2) For phage lambda, which of the following in needed for integration or exicision? A. integration needs Rz and IHF exicision needs int, IHF and Xis B. integration needs Int and IHF exicision needs Rz, IHF and Xis C. integration needs RecA and IHF exicision needs int, IHF and Xis D. integration needs Int and IHF exicision needs int, IHF and Xis E. integration needs ori and IHF exicision needs int, IHF and Xis F. integration needs Int and IHF exicision needs attC, IHF and Xis G. none of the above is a correct answer to the question (3) Which of the following statements about papillomavirus genome or gene expression is false? A. the Ori is in the LCR B. mRNAs transcribed from P earlynd at Poly(A)early C. L2 is expressed from unspliced mRNA generated from P late D. transcriptional regulation elements are present in the LCR E. splicing occurs in both BECs and keratinocytes F. vegetative replication requires high levels of E1 and E2 G. none of the above is a correct answer to the question (4) Which of the following is not caused by papillomavirus? A. common warts B . deep plantar warts C. skin cancer D. cervical cancer E. melanoma F. condyloma G. none of the above is a correct answer to the question (5) Which of the following about HSV is a correct match? (matches are separated by "") A. partial diploid inverted repeats b and c B. tegument  capsid proteins C. envelope  14 different glycoproteins D. capsid  T = 7 E. VP16  scaffolding protein F. latent infection HPV alpha- and beta-subfamilies only G. two of the above are correct matches NAME:_______ANSWERS______ STUDENT #:_______________________ 3 (6) Which of the following statements about HSV is false? A. the genome can be replicated by a rolling-circle mechanism B. some tegument proteins in the invading virion are transported into the nucleus C. UL41 degrades both viral and cellular mRNAs D. concatemers are long covalent multimers of the viral genome E. VP26 is a capsid protein F. most viral mRNAs are unspliced G. NC movement inside the nucleus is facilitated by dynein H. two of the above are correct answers to the question (7) Which of the following viruses generate subgenomic mRNAs that are 3’-coterminal with its genome? A. Flaviviruses B. Retroviruses C. Gammaretroviruses D. Influenza virus E. Togaviruses F. Lambda virus G. Coronaviruses H. two of the above are correct answers to the question (8) Which of the following mRNA sequences is predicted to be translated into a peptide of 7 amino acids most efficiently? (the start codon in underlined) A. 5’-AGGUAGAUGGUCCUUCAACUUGCCUGCUGACUAGCUAGCUAGCUACGUA B. 5’-AGGCAGAUG AUCCUUCAACUUGCCUGAAGAUAGCUAGCUAGCUACGUAC C. 5’-AGGGAGAUGGUCCUUCAACUUGCCUGGUAAUAGCUAGCUAGCUACGUAC D. 5’-AGGGAGAUG AUCCUUCAACUUGCCUGUUAGCUAGCUAGCUACGUAAUAC E. 5’-AGGUAGAUG GUCCUUCAACUUGCCUGUUAGUAGCUAGCUAGCUACGUAC F. 5’-AGGCAGAUG AUCCUUCAACUUGCCUGCUAACUAGCUAGCUAGCUACGUA G. 5’-AGGCAGAUG GUCCUUCAACUUGCCUGAUACCUAGCUAGCUAGCUACGUA H. 5’-AGGCAGAUG AUCCUUCAACUUGCCUAAUUACUAGCUAGCUAGCUACGUA (9) Which genus of Flaviviridae does not infect humans? A. Alphavirus B. Betavirus C. Gammavirus D. Flavivirus E. Pestivirus F. Hepacivirus G. Rubivirus H. none the above is a correct answer to the question (10) For togaviruses, which of the following is a correct match? A. nsP4  unknown function B. PE2  E2
More Less
Unlock Document

Only pages 1 and half of page 2 are available for preview. Some parts have been intentionally blurred.

Unlock Document
You're Reading a Preview

Unlock to view full version

Unlock Document

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit