Study Guides (380,000)
US (220,000)
UCLA (3,000)
LIFESCI (200)
Maloy (5)
Midterm

LIFESCI 7A Midterm: BIOLOGY 7A PRACTICE MIDTERM #2Exam


Department
Life Sciences
Course Code
LIFESCI 7A
Professor
Maloy
Study Guide
Midterm

This preview shows pages 1-3. to view the full 24 pages of the document.
BIOLOGY 7A
MIDTERM #2 PRACTICE EXAM
Weeks 5-7
Topics Covered:
1. Transcription
2. Translation and Protein Synthesis
3. Gene Regulation
*All learning objectives are included on this exam*
Name:______________________
SSID: _______________________

Only pages 1-3 are available for preview. Some parts have been intentionally blurred.

1. Label the following diagram.
2. Label the following diagram.

Only pages 1-3 are available for preview. Some parts have been intentionally blurred.

3-5: For the following DNA strands, write the complementary strand. Be sure to include
the 5’ and 3’ ends.
5’– AGGTACTGTAGCTGTAGTGTAGTCTA– 3’
3’–ATAGTCGATCGTGTACACAGTGTA–3’
5’–GTGCGCGCTGAGATGGCCTTAAGTC–3’
6. Define the purpose of the following in relation to transcription.
A. Promoter
B. Transcription factors
C. RNA polymerase
D. Enhancer
E. Transcription start site
F. Exons
G. Introns
H. Poly-A-Signal Sequence
I. Poly-A-Tail
J. Template
K. Non-Template
L. 5’Cap
7. Explain the process of transcription using the above terms.
You're Reading a Preview

Unlock to view full version