BIOLOGY 173 Study Guide - Final Guide: Atp Synthase, Start Codon, Restriction Site

163 views5 pages
20 Apr 2016
School
Department
Biology'172' ' Exam'2'
'
'
SA'1.'Above'please'find'a'metabolic'diagram'for'a'type'of'prokaryote.'Based'on'what'you'
learned'in'class,'please'answer'the'following'questions'(8'pts'total).'
'
A) Is'this'organism'an'autotroph'or'a'heterotroph'(2'pts)'and'why'(2'pts)?'!"#$#%$&'()*#+,)
#-./01)234)-05)%65"7/01)/#)8$%)7-%9$0)8/:-#/$0;)'
'
'
'
B) How'is'ATP'produced'(2'pts)?'Please'circle'the'electron'donor'(2'pts).'<=67#%$0,)8=$>)
#'%$"1')-0)6=67#%$0)#%-0,&$%#)7'-/0)#$)&%$?/56)606%1@)#$)A$?6)BC)-7%$,,)#'6)
7@#$&=-,A/7)D0$#)%6E"/%65F)A6A9%-06;)G$?6A60#)$8)BC)-7%$,,)#'6)A6A9%-06)
6,#-9=/,'6,)-0)BC)1%-5/60#H)>'/7')/,)",65)#$)&$>6%)!IJ),@0#'-,6)#$)A-.6)!IJ;'</#'6%)
BK()$%)K43LMK3)>6%6)-776&#65)-,)#'6)6=67#%$0)5$0$%;)DNO*)B43)/,)0$#)#'6)6=67#%$0)
5$0$%H)/#+,)#'6)8/0-=)6=67#%$0)-776&#$%H)P",#)=/.6)76=="=-%)%6,&/%-#/$0)/0)#'6)
A/#$7'$05%/$0F'
'
SA2.'Cyanide'(CNM)'rapidly'blocks'cell'growth'by'interfering'with'energy'production'(6'pts'
total)?''
' '
A) Which'cellular'process'does'cyanide'inhibit'(2'pts)''
'
<I2)$%)%6,&/%-#/$0H)$%)$:/5-#/?6)&'$,&'$%@=-#/$0)-%6)-776&#-9=6'
'
'
B) Please'explain'how'cyanide'blocks'energy'production'(4'pts)''
'
Unlock document

This preview shows pages 1-2 of the document.
Unlock all 5 pages and 3 million more documents.

Already have an account? Log in
Biology'172' ' Exam'2'
2@-0/56)9=$7.,)6=67#%$0)#%-0,&$%#)9@)9/05/01)#$)-)7$A&=6:)D7$A&=6:)*Q)0$#)
%6E"/%65F)-=,$)-776&#)<I2)A6A9%-06)&%$#6/0;))R/05/01)$8)7@-0/56)&%6?60#,)6=67#%$0)
#%-0,&$%#)&%6?60#/01)#'6)6,#-9=/,'A60#)$8)#'6)BC)1%-5/60#)-05)5/,%"&#/01)!IJ)
,@0#'6,/,)9@)!IJ),@0#'-,6;))
)
(S)/8)@$")5$0+#)A60#/$0)!IJ),@0#'6,/,;)
'
'
SA3.'You'wish'to'PCR'amplify'the'gene'sequence'below.'The'sequence'shown'is'the'top'and'
bottom'strands'of'the'target'sequence.'Please'design'two'primers'to'amplify'the'following'
sequence.'The'primers'need'to'be'written'in'the'5’'to'3’'direction'with'restriction'enzyme'cut'
sites'placed'appropriately'for'cloning'the'coding'region.'The'Cla'I'(5’ATCGAT)'site'should'be'in'
the'forward'primer'and'an'Nde'I'site'(5’CATATG)'in'the'reverse'primer'allow'for'8'base'pairs'to'
anneal'to'the'coding'region'including'the'DNA'corresponding'to'the'start'and'stop'codons.'The'
underlined'regions'correspond'to'the'start'codon'and'the'stop'codon'at'the'5’'and'3’'ends'of'
the'top'strand'respectively.'I'have'placed'GCC'on'the'5’'end'of'each'primer'to'get'you'started.''
5’ATGCTTAACGAGTGGTATTAGTCGGAAGACTGACAAAAGACTCAGATAA 3’
3’TACGAATTGCTCACCATAATCAGCCTTCTGACAGTTTTCTGAGTCTATT 5’
Primer'1'forward'(3'pts):'5’'GCCATCGATATGCTTAA'
Primer'2'Reverse'(3'pts):'5’'GCCCATATGTTATCTGA'
For each 3 pt part:
Checking for Restriction site:
+1 pt for restriction site right after the GCC and in the right orientation.
--+1/2 pt for restriction site but in the wrong position
--+1/2 pt for restriction site but in the wrong orientation
--no points if restriction site is in wrong position and wrong orientation
Checking for start and stop codons:
+ 1 pt for start and stop codon
--no points start and stop codons are missing
Checking for annealing sequence:
+ 1 pt for sequence in correct position and correct orientation
--no points for incorrect position and orientation.
No points deducted if forward and reverse mixed up.
'
'
'
'
'
Unlock document

This preview shows pages 1-2 of the document.
Unlock all 5 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Above please find a metabolic diagram for a type of prokaryote. Please circle the electron donor (2 pts). Electrons flow through an electron transport chain to provide energy to move h+ across the cytoplasmic (not required) membrane. Movement of h+ across the membrane establishes an h+ gradient, which is used to power atp synthase to make atp. Etc or respiration, or oxidative phosphorylation are acceptable: please explain how cyanide blocks energy production (4 pts) Cyanide blocks electron transport by binding to a complex (complex iv not required) also accept etc membrane protein. Binding of cyanide prevents electron transport preventing the establishment of the h+ gradient and disrupting atp synthesis by atp synthase. 1 if you don"t mention atp synthesis. You wish to pcr amplify the gene sequence below. The sequence shown is the top and bottom strands of the target sequence. Please design two primers to amplify the following sequence.

Get access

Grade+20% OFF
$8 USD/m$10 USD/m
Billed $96 USD annually
Grade+
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
40 Verified Answers