BIOL 111 Chapter Notes - Chapter 1: Emergence, Cell Theory, Eukaryote

66 views2 pages

amaranthcrow941

17 Sep 2015

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Emergent properties= properties that appear as things get more and more complex. Photosynthesis is an emergent property because it takes more than one organelle to perform it. Reductionism= reducing something to its simplest possible components. May miss emergent properties with this method! Systems biology= holistic approach; construct models for the whole system based on interactions among the system"s parts. Determined by dna sequence analysis: bacteria, archaea, eukarya. Scientific inquiry: facts, observations, hypotheses (tentative answers to questions, theories (well-supported arguments backed up by evidence) Hypotheses must be testable and falsifiable to be used in the scientific method. If it cannot be, then it is either not science, we don"t have enough information, or both. Evolution explains patterns of unity and diversity. Evolution needs : genetic variation in a population, a way for variation to be inherited, differences in reproductive success due to variation and environmental conditions. Mutations are random, but the consequences are not.

Related Questions

1. Water's molecular structure of water gives rise to 4 emergent properties that facilitate life on earth. Explain how the molecular structure of water contributes to each of these properties.

Explain why the structure of carbon makes it an excellent backbone for the molecules that compose living organisms.

2. Explain how water is involved in the synthesis and breakdown of biological macromolecules. in your answer, make sure to discuss the reactions that join and break apart monomers and why water is related to these processes.

Saturated and unsaturated fats have different fluidities at room temperature. Explain why this occurs.

Use the structural differences discussed in part 1 to explain why one type of fat can harm the cardiovascular system while the other has little negative effects.

Given that starch and cellulose are both made from the same monomer, why do you think that cellulose is so much more difficult for animal digestive systems to break down?

Most living organisms are extremely sensitive to changes in temperature and pH.

Use your knowledge of protein structure and the bonds involved to explain this sensitivity. make sure to be specific about levels of structure and bonds that are disrupted when temperature or pH change significantly.

Some living organisms such as gut microorganisms able to survive in environments with extreme pHs. What kind of modifications may they have in the amino acid composition of their proteins that facilitate their adaptation to this environment?

3. Explain how the internal structure of a cell isolated from the pancreas differs from that of a muscle cell.,

Compare the structures of animal and plant cells. How are they different? how are they the same?

Edema is a medical condition that results from fluid leaking out of blood vessels into surrounding tissues. using your knowledge of animal cell junctions, hypothesize what type of junction may be malfunctioning in individuals suffering from edema and explain why you believe your hypothesis to be correct.

burgundyplatypus4

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

Bacterial cells are used to express proteins from other organisms. Your lab has isolated a human gene that encodes an enzyme that want to produce in a bacterial cell. You can stably transfer the human gene, along with its promoter into a bacterial cell but no human protein is made. Assume that youâve done the procedure correctly and have established that the sequence youâve used is the reason for the lack of protein. How can this be explained? 1.5 pts

Once you solved this initial problem, you can detect RNA from the human gene in the bacterial culture. However, the mRNA is twice as long as the mRNA isolated from this gene in humans and the enzyme coded for by the gene does not appear to be functional. Explain why. 1.5 pts

BIOL 111 Chapter Notes - Chapter 1: Emergence, Cell Theory, Eukaryote

Document Summary

Get access

Related Documents

BIOL 111 Lecture Notes - Lecture 1: Deductive Reasoning, Negative Feedback, Protist

BIOL 111 Chapter Notes - Chapter 1: Model Organism, Inductive Reasoning, Deductive Reasoning

BIOL 111 Final: All you need for the Final! 77 Page Study Guide

Related Questions