BIOL 2100 Chapter Notes - Chapter 16.2: Dna Replication, Phosphate, Semiconservative Replication

29 views2 pages

limesardine98

25 Oct 2016

School

University of Virginia

Department

Biology

Course

BIOL 2100

Professor

Kittlesen David

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

16. 2 many proteins work together in dna replication and repair. Dna strands are complementary to each other. Old strands serve as templates for new strand to copy onto using base pairing rules. Dna: meselso(cid:374) a(cid:374)d stahl"s e(cid:454)peri(cid:373)e(cid:374)t pro(cid:448)ed the dna replication made semiconservative strands. Single-strand binding proteins prevent dna strands from repairing with each other. Topoisomerase relieves strain caused later on in the dna. Primer (short rna chain) made by rna primase: ne(cid:449) dna stra(cid:374)d added to rna pri(cid:373)er, goi(cid:374)g fro(cid:373) 3" to 5". Dna polymerase adds nucleotides to the chain. As each nucleotide joins, it loses 2 phosphate groups (pyrophosphate) In e. coli, dna polymerase iii adds dna nucleotide to rna primer: hydrolyzed to form 2 molecules of inorganic phosphate. Synthesized in series of fragments (okazaki fragments) Dna ligase joins all the backbones of fragments, forming a continuous strand. Dna polymerase i re(cid:373)o(cid:448)es rna pri(cid:373)er fro(cid:373) 5" e(cid:374)d a(cid:374)d repla(cid:272)es the(cid:373) (cid:449)ith dna nucleotides.

Related Questions

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

ceruleangnat663

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 2100 Chapter Notes - Chapter 16.2: Dna Replication, Phosphate, Semiconservative Replication

Document Summary

Get access

Related Documents

BIOL 2100 Chapter Notes - Chapter 16: Nucleic Acid Double Helix, Dna Replication, Bacteriophage

BIOL 2100 Study Guide - Midterm Guide: Semiconservative Replication, Deoxycytidine Triphosphate, Thymidine Triphosphate

BIO 311C Lecture Notes - Lecture 17: Chromosome, Primase, Franklin Stahl

Related Questions