CHEN 3701 Lecture Notes - Lecture 28: Clastic Rock, Telecommunications Services Of Trinidad And Tobago, Thai Poetry
2 Nov 2015
School
Department
Course
Professor
Document Summary
Acatatgagaatcggacatactagtgaacagtgacctaagttag (dna) replication: dna --> dna (1 copy --> 2 copy) Translation: mrna --> protein: circle the codon whose mrna transcript enables the start of translation. 5" acatatgagaatcggacatactagtgaacagtgacctaagttag 3: write the product of dna replication of this genomic dna you make 2 copies (not 1 copy) of this double-stranded dna. 3" tgtatactcttagcctgtatgatcacttgtcactggattcaatc 5: write the product of transcription. Rna polymerase looks like the dna strand on top template strand mrna will have the same sequence as the 5" --> 3" strand but w/ u instead of t the mrna will be. 5" acauaugagaaucggacauacuagugaacagugaccuaaguuag 3" it will look like 5" to 3" strand, not the 3" to 5" strand: write the product of translation --> start @ start codon, ends at stop (terminal) codon. 5" atg aga atc gga cat act agt gaa cag tga. 5" m r i g h t s e q stop the solution is mrightseq translation: mrna --> protein mrna is single-stranded.
