BIOL 150 Lecture Notes - Lecture 8: Mating Call, Nitrogenous Base, Cytosine

20 views2 pages

blushcrocodile584

11 Sep 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Describe the structure of dna- double helix ; raw material of evolution. Summarize the central dogma (dna rna protein) Explain how genes relate to the traits you see in organisms. Explain how mutations can lead to changes in phenotype. 5-carbon sugar- numbered from right, moves clockwise, pointed ends are carbons. Polymerizes into single strands of dna which are hydrogen bonded together. Dna structure is the same in every organism bacteria to human. Broadly speaking: the sequence of bases on dna codes for the sequence of amino acids in a protein . Central dogma: dna codes for rna which codes for protein. Only 1. 5% of dna codes for protein. Lots of dna codes for regulatory rna. Rna can double-back on itself and pair a complete structure. Prokaryotes have naked dna that is not spooled up. Is universal: same in all organisms (bacteria to human)

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 150 Lecture Notes - Lecture 8: Mating Call, Nitrogenous Base, Cytosine

Document Summary

Get access

Related Documents

BIOL 150 Study Guide - Final Guide: Cytosine, Phosphodiester Bond, Uracil

BIOL 150 Chapter Notes - Chapter 4: Hydrophile, Uracil, Rna World

BIOL 150 Chapter Notes - Chapter 15: Xeroderma Pigmentosum, Proofreading, Chromosome

Related Questions