BIOL 1011 Chapter : Chapter 8 Qs
Get access
Related Documents
Related Questions
Question 9
Codominance is a form of inheritance in which two different allelesfor a gene are both expressed, and neither allele is dominant overthe other. One example of codominance is fur color in cattle; thealleles for red fur and white fur are codominant. If a homozygousred cow and a homozygous white bull mate, what would you expect tofind in their offspring?.912.l.16.2>
They will all have white fur.
Their fur will be a mixture of red and white hairs.
Their fur will be a lighter shade of red.
They will all have red fur.
Question 10
If a tRNA molecule has an anticodon which reads AUG, what will itmatch up with and what amino acid is it carrying?
.912.l.16.5>
U | C | A | G | ||||||
UUU | Phenylalanine | UCU | Serine | UAU | Tyrosine | UGU | Cysteine | U | |
U | UUC | Phenylalanine | UCC | Serine | UAC | Tyrosine | UGC | Cysteine | C |
UUA | Leucine | UCA | Serine | UAA | Stop | UGA | Stop | A | |
UUG | Leucine | UCG | Serine | UAG | Stop | UGG | Tryptophan | G | |
CUU | Leucine | CCU | Proline | CAU | Hisitidine | CGU | Arginine | U | |
C | CUC | Leucine | CCC | Proline | CAC | Hisitidine | CGC | Arginine | C |
CUA | Leucine | CCA | Proline | CAA | Glutamine | CGA | Arginine | A | |
CUG | Leucine | CCG | Proline | CAG | Glutamine | CGG | Arginine | G | |
AUU | Isoleucine | ACU | Threonine | AAU | Asparagine | AGU | Serine | U | |
A | AUC | Isoleucine | ACC | Threonine | AAC | Asparagine | AGC | Serine | C |
AUA | Isoleucine | ACA | Threonine | AAA | Lysine | AGA | Arginine | A | |
AUG | Methionine/Start | ACG | Threonine | AAG | Lysine | AGG | Arginine | G | |
GUU | Valine | GCU | Alanine | GAU | Aspartate | GGU | Glycine | U | |
G | GUC | Valine | GCC | Alanine | GAC | Aspartate | GGC | Glycine | C |
GUA | Valine | GCA | Alanine | GAA | Glutamate | GGA | Glycine | A | |
GUG | Valine | GCG | Alanine | GAG | Glutamate | GGG | Glycine | G |
It is carrying arginine and will match with a CGU codon on themRNA.
It is carrying methionine and will match with a TAC codon on theDNA.
It is carrying methionine and will match with a UAC codon on themRNA.
It is carrying tyrosine and will match with a UAC codon on themRNA.
Question 11
While the DNA in a human skin cell was being replicated, a singlebase was miscopied. What will be the most likely result of this forthe cell in which it happened?.912.l.16.3>
All the proteins the cell creates from the miscopied strand willdo different jobs than the old ones.
If the new sequence codes for the same amino acid as theoriginal cell, it will function normally.
Both new DNA strands will end up together in a new cell, and theinaccurate one will be discarded.
Any miscopied DNA will be replaced with an accurate DNA copyonce the cell divides.
Question 12
A ferret's haploid number of chromosomes is 20. How would thenumber of chromosomes in the ferret's body cells compare to thenumber of chromosomes in its gametes?.912.l.16.17>
Its body cells would have 20 chromosomes, and its gametes wouldhave 40 chromosomes.
Its body cells and gametes would both have 40 chromosomes.
Its body cells and gametes would both have 20 chromosomes.
Its body cells would have 40 chromosomes, and its gametes wouldhave 20 chromosomes.
Question 13
A body cell is in the longest stage of its life cycle. The cellgrows, synthesizing proteins and increasing in size. Eventually,the cell will grow too large to carry out normal activities. Whichof the following is the best conclusion you can make about the lifecycle of this cell?.912.l.16.14>
The cell is close to the end of its life cycle, and a chemicalsignal will initiate cell death.
The cell is ready to undergo mitosis, and a chemical signal willsend the cell to prophase.
The cell is in the G1 phase of interphase, and a chemical signalwill send the cell to the S phase.
The cell is in the S phase of interphase, and a chemical signalwill move the cell to the G2 phase.
Question 14
While mRNA strands are being created a sequence is sometimesmiscopied. What is the best possible outcome for the cell shouldthis take place?.912.l.16.5>
The miscopied sequence codes for the same amino acids as theoriginal sequence.
The new sequence creates a protein that serves a differentfunction from the original.
The ribosomes will correct the mistake before the tRNA matchesan amino acid to it.
The mRNA will only be used to create non-critical proteins forthe cell.
Question 15
Over the last several decades, the scientific community hasgathered a large amount of information regarding genetics andgenetic variation. What are two main sources that lead toincreased genetic variation?.912.l.15.15>
Selective breeding
Gamete mutations
Recombination
Genetic drift
SEQUANCE:
5'- GCU UGG GCU GCU GAU GCU CUU UAA CAU AGA GCU AAU AUU -3'
=======================================================================================
3- Convert your mRNA sequence into a DNA sequence, then make itdouble-stranded by writing the complementary sequence below.
4- Transcribe (write an RNA sequence) and translate (write anamino acid sequence) both the "top" and "bottom" strands startingwith the first nucleotide. You must use the genetic code in yourtextbook or in your lecture notes for this step. DO NOT use thetable above. If you encounter a stop codon, your protein sequenceis done at that point.
Use the single letter designation for amino acids as givenbelow.
Alanine (A) | Aspartic acid (D) | Asparagine (N) | Arginine (R) |
Cysteine (C) | Glycine (G) | Glutamic acid (E) | Glutamine (Q) |
Histidine (H) | Isoleucine (I) | Leucine (L) | Lysine (K) |
Methionine (M) | Proline (P) | Phenylalanine (F) | Serine (S) |
Threonine (T) | Tryptophan (W) | Tyrosine (Y) | Valine (V) |
5- Use your original DNA sequence from #3. Add an A to the 5'end of the "top" strand, then write the complementary sequence onthe bottom. Add a GC to the 5' end of the
"bottom" strand, then write the complementary sequence on the top.Transcribe and translate both the "top" and "bottom" with this newsequence.
What kind of mutation(s) was introduced in the "top" strand?
What kind of mutation(s) was introduced in the "bottom"strand?
6- Use your original DNA sequence from #3. Starting at the 5'end on the "top" strand of your original sequence from part 3,delete the second A, the third G, and the fourth C along with thecomplementary nucleotides on the bottom strand. Transcribe andtranslate both the "top" and "bottom" with this new sequence.
What kind of mutation(s) was introduced in the "top" strand?
What kind of mutation(s) was introduced in the "bottom"strand?
7. Use your original DNA sequence from #3. Starting at the 5'end of the "top" strand, change the third G to an A, then changethe complementary nucleotide in the bottom. Starting at the 5' endof the "bottom" strand, change the third C to a T, then change thecomplementary nucleotide on the top. Transcribe and translate boththe "top" and "bottom" with this new sequence.
a. What kind of mutation(s) was introduced in the "top"strand?
b. Whatkind of mutation(s) was introduced in the "bottom" strand?
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?