BIO206H5 Lecture Notes - Lecture 1: Dnaa, Dna Replication

112 views3 pages

ceruleanporcupine379

22 Jun 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

1a) conservative- when there is a dna molecule with two old strands, or a dna molecule with two new strands: semi-conservative- when there is a dna molecule with one old stand and one. They grew e. coli in 15n and 14n, with 15n being a heavy isotope, and 14n being a light isotope. They took samples from each after the first, second, and third generations, then mixed with cesium chloride, and separated the dna. The results indicated that half of the dna was light and the other half heavy after the first generation, and half of the dna was light and the other half intermediate after the second generation. 4a) helicase unzips dna strands to allow for the attachment of nucleotides that are used as a template: primases synthesize short rna sequences that are complementary to a single-stranded. Dna: dna polymerase uses nucleotides to make dna.

Related Questions

In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Streptococcus pneumoniae demonstrated that

	DNA is a double helix.
	DNA may be taken up by bacterial cells and be active.
	DNA is present in bacteriophage T2.
	eukaryotic cells may be genetically transformed.
	DNA binds to the cell wall of the bacterium.

In order to show that DNA in cell extracts is responsible for genetic transformation in Streptococcus pneumoniae, important corroborating evidence should indicate that _______ also destroy transforming activity.

	temperatures high enough to kill cells
	enzymes that hydrolyze proteins
	enzymes that hydrolyze DNA
	enzymes that hydrolyze polysaccharides
	enzymes that hydrolyze RNA

Based on what you have learned about the experiments conducted by Griffith and Avery and colleagues with bacteria, which of the following would result in transformation of living R cells?

	Pure RNA from S cells
	Cell-membrane extracts from S cells
	A mixture of pure RNA and protein from S cells
	Cell-free extracts from S cells
	Pure protein from S cells

A-T base pairs in a DNA double helix

	form three hydrogen bonds with each other.
	are more heat-stable than G-C base pairs.
	are of a substantially different length than G-C base pairs.
	are not accessible to DNA binding proteins.
	are chemically distinct from G-C base pairs.

If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the bases are uracil?

	27
	50
	0
	73
	23

The uniform diameter of the DNA structure provides evidence for

	antiparallel DNA strands.
	a right-handed helix.
	a double-stranded helix.
	3â² end phosphorylation.
	purineâpyrimidine pairing.

If a sequence of one strand of DNA is 5â²-TGACTATC-3â², what is the complementary strand?

	5â²-ACTGATAG-3â²
	3â²-TGACTATC-5â²
	3â²-ACTGATAG-5â²
	3â²-ACTGATAG-3â²
	5â²-TGACTATC-3â²

What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication?

	3â² end phosphorylation
	Purineâpyrimidine pairing
	Antiparallel DNA strands
	Covalent bonds between sugars and phosphate groups
	Hydrogen bonding between paired bases

If the MeselsonâStahl density gradient experiment had resulted in two bands of DNA molecules after only one round of replication, one containing only ¹⁵N and the second only ¹⁴N, this result would have indicated that replication was

	unidirectional.
	dispersive.
	conservative.
	bidirectional.
	semiconservative.

10.

The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3â² hydroxyl group (âOH). Predict what will happen if the host cell DNA polymerase incorporates a molecule of acyclovir into an elongating strand of HSV DNA.

	The replication complex will no longer bind to origins of replication.
	The DNA polymerase will only incorporate acyclovir molecules.
	Acyclovir will bind single-strand binding proteins.
	DNA polymerase will not be able to link a successive nucleotide.
	Acyclovir will block the activity of the DNA helicase.

11.

Which of the following does not demonstrate the stability of the DNA double helix?

	Single-strand binding proteins are required to keep the strands apart.
	Paired bases form hydrogen bonds.
	High temperatures are required to denature it.
	DNA synthesis requires energy.
	DNA helicases require ATP.

12.

What effect would a primase inhibitor have on DNA replication?

	DNA polymerase would not be able to add bases to the DNA.
	Primase would be blocked from joining the DNA replication complex.
	Primase would not be able to provide primers for DNA polymerases.
	DNA polymerase would not be able to use DNA as a template.
	There would be no effect on DNA replication.

13.

To replicate their DNA in a timely manner, most eukaryotic chromosomes

	normally have uncoiled DNA.
	have multiple origins of replication.
	contain linear molecules of single-stranded DNA.
	have two replication forks that move in the same direction.
	are composed entirely of DNA.

14.

Which statement about DNA replication is false?

	Okazaki fragments are synthesized as parts of the leading strand.
	Error rates for DNA replication are reduced by proofreading of the DNA polymerase.
	The sliding clamp increases the rate of DNA synthesis.
	Replication forks represent areas of active DNA synthesis on the chromosomes.
	Ligases and polymerases function in the vicinity of replication forks.

15.

In many eukaryotes, there are repetitive sequences called telomeres at the ends of chromosomes. After successive rounds of DNA replication, the _______ strand becomes shorter. In some cells, an enzyme called _______ repairs the shortened strand.

	leading; telomerase
	lagging; telomerase
	lagging; DNA polymerase I
	leading; DNA polymerase I
	leading; replicase

16.

A researcher studies normal human fibroblast cells. They can be maintained in culture but die off after about 30 cell generations. Unexpectedly, a colony of cells continues to survive and divide past 30 generations. Which scenario is most likely true for these cells?

	DNA polymerase is constantly active.
	Primase is able to extend the telomeres.
	The mismatch repair system is extra efficient.
	The telomerase gene is being expressed.
	The cells do not need the ends of their chromosomes.

17.

If DNA polymerase III introduces an incorrect nucleotide, what is the first corrective action made by the DNA repair system?

	The replication complex excises the incorrect nucleotide.
	The excision repair proteins remove the incorrect nucleotide.
	The mismatch repair system scans for base-pairing mismatches.
	There is no correction, because nucleotide errors by DNA polymerases are not repaired.
	DNA ligase connects the correct nucleotide.

18.

Choose the correct order of the following four events in the excision repair of DNA:
(1) Base-paired DNA is made complementary to the template.
(2) Damaged bases are recognized.
(3) DNA ligase seals the new strand to existing DNA.
(4) Part of a single strand is excised.

	1, 2, 3, 4
	2, 1, 3, 4
	3, 4, 2, 1
	2, 4, 1, 3
	4, 2, 3, 1

19.

Six complete cycles of PCR should result in a _______-fold increase in the amount of DNA.

	64
	32
	12
	128
	6

20.

When double-stranded DNA is heated to temperatures above 90Â°C, it denatures. Denaturation is a process that

	breaks covalent bonds.
	hydrolyzes DNA.
	separates double-stranded DNA into two single strands.
	causes new hydrogen bonds to form.
	irreversibly destroys the double helical structure.

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

1. In Humans, many types of cancers have been linked to?

A. Duplications
B. Inversions
C. translocations
D. deletions
E all of these

2. 5- bromoouracil is mutagenic because it is a(n)

a. base-modifying agent
b. base analog
c. intercalating agent
d. alkylating agent.

3.Ultraviolet radiation creates __________ in DNA

A. 5-methyl cytosine residues
B. breakages
C point mutations
D. mutational hot spots
E thymine dimers

4. The telomeres of chromosomes is composed of

A. heterochromatin
b. nucleosome
c. histone
d. achromatic

5. In eukaryotes, a replicon is

a. the distance between the origin of replication and thetermination of replication
b. a single chromosome
c. the entire genome
d. one DNA strand of a single chromosome

6. In a nonreciprocal interchomosomal translocation, a segment of achromosome is

a. exchanged with an identical segment on a differentchromosome
b. exchanged with an identical segment on a sister chromatid
c. transferred to a different chromosome without a reciprocalexchange of genetic material
d. transferred to a new location on the same chromosome without areciprocal exchange of genetic material

7. Somatic mutations are always.

a. spontaneous
b. carcinogenic
c. heritable
d. lethal
e. none of these

8. A woman with an XO genotype is

a. aneuploid
b. euploid
c. diploid
d. poluploid

9. Spontaneous mutations may occur as a result of

a. all of these
b. errors in DNA replication
c. transposition
d. none of these
e. normal cell biochemistry

10. In the semi conservative model of DNA replication, progenydouble helices consist of

a. one parental DNA strand and one new strand
b. one parental DNA strand and one new RNA strand
c. two new RNA strands
d. two parental DNA strands
e. two new DNA strands

11. A mutation in a gene may alter a cellâs

a. phenotype
b. genotype and phenotype
c. genotype

12. During replication, the direction of synthesis of new DNA fromthe leading strand is

a. both 5â to 3â and 3â to 5â
b. none of these
c. 3â to 5â
d. from left to right only
e. 5â to 3â only

13. A mutation that results in a switch from a purine-pyramidingbase pair to a pyramiding-purine base pair is a _________mutation.

a. neutral
b. transition
c. missense
d. transversion
e. nonsense

14. A trisomic human cell would contain how many chromosomes?

a. 45
b. 46,
c. 47.
d. 48

15. In a strand of DNA, a _____________ bond connects the phosphategroup of one nucleotide to the sugar of the adjacentnucleotide

a. hydrogen
b. ester
c. phosphodiester
d. phosphate
e. disulfide

16. Cri-du-chat syndrome is caused by which type of chromosomalmutation?

a. deletion
b. duplication
c. translocation
d. transversion
e. inversion

17. During replication, the role of DNA primase is to

a. add nucleotide to the growing DNA chain
b. synthesize a short chain for RNA
c. untwist the double helix at the origin of replication
d. relax the super coiling of the double helix
e. synthesize the primo some

18. A(n) ____________ inversion involves the Centro mere

a. chromocentric
b. paracentric
c. epicentric
d. percentric
e. concentric

19. Which of the following substances mutates DNA by intercalatingbetween adjacent base pairs?

a. methyl methane sulfonate
b. all of these
c. nitrous acid
d. 2-amino urine
e. acridine orange

20. A molecule of RNA is always

a. double stranded
b. helical
c. nonparallel
d. all of these
e. none of these

21. Mutagenesis of cells using radiation or a chemicalintercalating agent could be used to create __________ mutations ina region of DNA.

a. random
b. both random and site-specific
c. site-specific

22. In Griffithsâs tranformation experiments, the mice died whenthey were injected with

a. living, no virulent bacteria
b. living, virulent bacteria
c. heat-killed, no virulent bacteria
d. living, nonvirulent bacteria
e. both B and D

23. A monoploid human cells

a. shows only the excessive phenotype of all these genes
b. would be functionally impaired
c. is normal
d. would not survive

24. Gametes containing an abnormal number of chromosomes may occuras a result of

a. paracentric inversion
b. reciprocal translocation
c. disjunction of chromosomes
d. unequal crossing over

25. DNA may be altered as a result of _____________ events thatoccur normally in cells

a. depurination
b. deamination
c. depyrimidation
d. all of the above
e. none of the above

26. Which enzyme prevents DNA from tangling up as the replicationfork migrates during replication?

a. DNA polymerase I
b. DNA helicase
c. topoisonmerase
d. DNA polymerase III
e. DNA gyrase

27. Which of the following enzymes play an important role in DNAreplication?

a. DNA helicase
b. DNA ligase
c. DNA primase
d. all of them
e. DNA polymerase III

28. A mutation gene sustains a mutation that restores the originalphenotype, This is a

a. frame shift mutation
b. transversion
c. reversion
d. transition
e. forward mutation

29. A dicentric chromosome has two

a. telomeres
b. mutations
c. arms
d. centromeres

30. Which type of chromosomal mutation cannot revert to thewild-type state

a. duplication
b. deletion
c. translocation
d. both A and C
e. all of them

31. Translation of histone mRNAs occurs during which phase of theeukaryotic cell cycle?

a. M
b. G1
c. G2
d. S
e. all of these

32. After removal of the RNA primers, Okazaki fragments are joinedthrough a reaction that involves which enzyme?

a. RNA polymerase
b. DNA helicase
c. DNA polymerase
d. DNA primase
e. DNA ligase

33. Which of the following is required for the synthesis of DNAduring replication?

a. DNA polymerase
b. magnesium ions
c. all of them
d. template DNA
e. dNTPs

34. Most of the genome of an active cell consists of

a. heterochromatin
b. histochromatin
c. poluchromatin
d. euchromatin

35. In eukaryotes, DNA replication begins,

a. a single origin of replication on each chromosome
b. a single origin of replication on each chromosome
c. multiple origins of replication on each chromosome
d. all of the above
e. none of the above

36. A human cell contains 2 sets of 24 chromosomes is

a. euploid
b. haploid
c. polyploid
d. aneuploid

37. Pseudodominance occurs as a result of which type ofmutation?

a. translocation
b. duppolication
c. all of these
d. point mutation
e. deletion

38. The enzymatic activity of a telomerase is best described asa

a. none of these
b. polymerase
c. ligase
d. reverse transcriptase
e. topoisomerase

39. A Barr body is an example of

a. constitutive heterochromatin
b. facultative heterochromatin
c. facultative euchromatin
d. constitutive euchromatin

40. An addition or deletion of one or two base pairs in a genecauses a ____________ mutation

a. Transition
b. frameshift
c. nonsense
d. transversion
e. neutral

41. A heterozygous chromosomal inversion can be detected

a. by cytogenetic observation of loops in chromosomes
b. through genetic studies indicating a decrease in the frequencyof recombination between genes
c. by observing a decrease in the number of viable progenyfollowing genetic crosses
d. all of the above

42. The mutagen 5-bromouracil is an analog of which base?

a. adenine
b. threonine
c. thymine
d. cystosine
e. uracil

43. A mutation that changes a codon from one that represents anamino acid to one that signals a chain termination is a______________ mutation.

a. neutral
b. missense
c. frame shift
d. nonsense

44. A chromosomal mutation that results in an increase in theamount of DNA is a(n)

a. duplication
b. inversion
c. deletion
d. both A and C
e. all of the above

45. Prior to replication, the DNA double helix must be untwisted bywhich type of enzyme?

a. topoisomerase
b. ligase
c. polymerase
d. helicase
e. primase

46. In his transformation experiments, Griffiths used cultures ofwhich bacterium?

a. Sacchromyces cerevisiae
b. Escherichia coli
c. Streptococcus pneumoniae.
d. Bacillus cereus
e. Eneterococcus faecalis

47. A mutation changes a codon from a UCG to a UAG. This is a____________ mutation?

a. point
b. nonsense
c. silent
d. both A and B
e. all of the above

48. In eukaryotes, DNA replication

a. is initiated at several sites on chromosomes
b. occurs bidirectional
c. is semidiscontinuous
d. all of the above
e. none of the above

49. Which of the following bacteria are used in the Amestest?

a. Pseudomonas aeruginosa
b. Escherichia coli
c. Vibrio cholera
d. Salmonella typhimurium
e. Rickettsia rickettsii

50. Which of the following changes represents a missensemutation?

a. UGA (stop) to UAG (stop)
b. AAA (lysine) to AGA (arginine)
c. UUU (phenylalanine) to UAA (stop)
d. AUG (methionine) to UGA (stop)
e. AAA (lysine) to AAG (lysine)

BIO206H5 Lecture Notes - Lecture 1: Dnaa, Dna Replication

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Concepts of Biology

Biology

Essentials of Biology

Related Documents

BIO206H5 Study Guide - Final Guide: Dna Polymerase Iii Holoenzyme, Dna Polymerase Ii, Dna Replication

BIO206H5 Lecture : Replication Worksheet Complete

BIO206H5 Lecture Notes - Lecture 6: Okazaki Fragments, Dna Ligase, Semiconservative Replication

Related Questions