BISC 1112 Lecture Notes - Lecture 2: Transfer Rna, Valine
30 views1 pages
![](https://new-preview-html.oneclass.com/1JRV4BM2KWx7j7bnkGZymndkAG6LgqaP/bg1.png)
Quiz 3 (2) Lecture Notes: Transcription in a Cell BISC 1115
1
• Replication of DNA in the nucleus makes an identical copy of the DNA so the cell can divide
• Transcription of some of the DNA makes complimentary mRNA, tRNA, and rRNAs. DNA
contains the information to make proteins; this involves transcribing the sequence of nucleotides in
the DNA to make an RNA sequence
• Post-Transcription- mRNA is cut and spliced in the nucleus
• Translation of the code in mRNA assembles amino acids to make a protein. Nucleotide sequences in
the RNA are translated in ribosomes to assemble amino acids to make a protein
• The genetic Code- the code consists of sets of 3 nucleotides that are read in the 5’ to 3’ direction in
the mRNA
o 5’ GUC codes for valine, which has a nonpolar, hydrophobic chain. Use the genetic code
wheel to transcribe and translate a gene in a DNA sequence
o 5’ GAC codes for aspartic acid, which is acidic because it has a carboxyl group (-COOH)
• DNA Template/mRNA
o 3’ TACGCTGAAAGTCTCCAGATTTGCTGG 5’
o 5’ AUGCGACUUUCAGAGGUCUAAACGACC 3’
find more resources at oneclass.com
find more resources at oneclass.com
Unlock document
This preview shows half of the first page of the document.
Unlock all 1 pages and 3 million more documents.
Already have an account? Log in
Get access
Grade+
$40 USD/m
Billed monthly
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
10 Verified Answers
Class+
$30 USD/m
Billed monthly
Homework Help
Study Guides
Textbook Solutions
Class Notes
Textbook Notes
Booster Class
7 Verified Answers
Related Documents
Related Questions
DNA Structure and Function LabReport
- DNA Structure
- Which two scientists are credited with discovering DNA?
- Name the nitrogen bases that are purines.
- Which nitrogen base pairs with thymine?
- List the three components of a nucleotide.
- DNA Replication
- What is the purpose of DNA replication?
- How many times does replication occur in the life of acell?
- In the Lab, Exercise 2, the original strand on the left had thebases shown below. Input the new bases that correctly pair with theoriginal strand.
Original | New |
C | |
A | |
G | |
T |
- RNA Structure
- Describe the structure and function of RNA.
- Refer to Exercise 3 and record the bases of the RNA strandproduced from the replicated DNA strand.
DNA | RNA |
C | |
A | |
G | |
T |
- Record the differences between DNA and RNA in the tablebelow.
DNA | RNA | |
Sugars | ||
Bases | ||
Strands |
- RNA Synthesis
- The process of assembling RNA is called _________.
- How is replication different from transcription?
- Refer to Exercise 4. Write the letters for the base sequence ofmRNA in the spaces below DNA. Note that the order is reversed;start with the 3â end of the DNA strand and the 5â end of the mRNAstrand. Transcription is DNA to mRNA. Note RNA contains Uracilinstead of Thymine; There is no thymine in RNA.
DNA | 3â | C | G | T | C | G | T | C | C | A | A | T | T | 5â |
mRNA | 5â | 3â |
- Protein Synthesis
- What type of RNA provides amino acids to build polypeptidechains?
- If a mRNA strand has the bases 5â CUC 3â, what amino acid willbe translated? Refer to the printable chart in Exercise 5.
- Where in the cell does translation occur?
- Genes
- What could be the problem if there is a change in the basesequence of a gene as it is passed down to the offspring?
- Give an example of a disorder that results from changes in theamino acid sequence.
- What causes sickle cell anemia?
- Gene Cloning
- What is the function of a plasmid?
- Print the document from Lab, Exercise 6. Complete the activityalong with the video demonstration. Sign, date, and take an imageof your final product and include with this lab report.