END 319 Lecture Notes - Lecture 15: Tata Box, Sigma Factor, Intrinsic Termination

18 views2 pages

cyanmink520

3 Jun 2019

School

University at Buffalo

Department

Environmental Design

Course

END 319

Professor

all

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

It provides the binding site for general transcription factors and rna polymerase. Tata box - ?a sequence found within eukaryotic core promoters that determines the starting site for transcription. The tata box is recognized by a tata-binding protein, which is a component of tfiid basal transcription - ?in eukaryotes, a low level of transcription via the core promoter. The binding of transcription factors to enhancer elements may increase transcription above the basal level regulatory sequences - ?a sequence of dna (or possibly rna) that binds a regulatory protein and thereby influences gene expression. Bacterial operator sites and eukaryotic enhancers and silencers are examples enhancer - ?a dna sequence that functions as a regulatory element. The binding of a regulatory transcription factor to the enhancer increases the level of transcription. silencer - ?a dna sequence that functions as a regulatory element.

Related Questions

Which type of RNA is unique to eukaryotes?

		mRNA
		rRNA
		tRNA
		snRNA
		Its a trick, all cells have all four types of RNA.

1 points

QUESTION 2

The region of DNA to which RNA polymerase binds to initiate transcription is the:

		origin
		promoter
		enhancer
		none of the above are correct

1 points

QUESTION 3

Holoenzyme:

		is RNA polymerase core enzyme.
		is sigma factor.
		is core plus sigma factor.
		none of the above are correct.

1 points

QUESTION 4

Which of these is formed FIRST when RNA polymerase binds to a promoter?

		The closed promoter complex
		The open promoter complex
		A rho-independent terminator
		none of the above are correct.

1 points

QUESTION 5

A hairpin loop followed by a run of Us:

		is the sequence formed in the sense strand of a gene using a rho-independent terminator.
		is the sequence recognized by the rho protein.
		is the structure formed in RNA that causes rho-independent termination.
		is formed immediately after the open promoter complex is formed.

1 points

QUESTION 6

RNA polymerase:

		reads the template strand of the DNA in the 3' to 5' direction.
		synthesizes the RNA in the 5' to 3' direction.
		can begin transcription without a primer.
		all of the above are correct.

1 points

QUESTION 7

Which of the following statements is FALSE?

		Bacteria like E. coli have only one type of sigma factor.
		RNA polymerase has no proofreading activity.
		The promoter of a gene is upstream of the RNA-coding region.
		Bacterial transcriptional terminators are copied into RNA to cause termination.

1 points

QUESTION 8

If the template strand of a gene has the sequence 5' ATGCGAT 3', then:

		the RNA produced will have the sequence 5' AUGCGAU 3'.
		the RNA produced will have the sequence 5' UAGCGUA 3'.
		the RNA produced will have the sequence 5' AUCGCAU 3'.
		None of the above are correct.

1 points

QUESTION 9

The sense strand:

		is the lagging strand
		is also the template strand.
		always goes left to right.
		none of the above are correct.

1 points

QUESTION 10

Which of these is transcribed but not translated?

		mRNA
		tRNA
		rRNA
		all of the above
		tRNA and rRNA are transcribed but not translated.

please help i am a bit confused

5. Alpha amanitin is a drug that binds RNA polymerase andprevents it from functioning in the cell (this is the compound thatis found in poison mushrooms). The reason people die when theyconsume alpha amanitin is:

a) Alpha amanitin prevents gene expression from occurring in thecell

b) DNA replication is directly inhibited by alpha amantin

c) Alpha amanitin binds tightly to the messenger RNAs that aremade in the cell, preventing translation

d) Alpha amanitin binds to nuclear pores preventing thetransport of messenger RNA into the cytoplasm

6. In order for transcriptional initiation to begin in E. colithe following elements are needed:

a) an origin and RNA polymerase

b) initiator protein and a promoter

c) the sigma subunit of RNA polymerase and an RNA template

d) RNA polymerase and a promoter

e) helicase and primase

Questions 7 and 8. You are studying two species of closelyrelated snakes, one species lives in sandy desert area and has paletan skin and the species lives in a volcanic rock area and has darkbrown skin. You a sequence the DNA from each type of snake anddiscover a gene encoding a protein that transports pigment into theskin cells. The pigment transporter protein is responsible for skincolor. When you analyze the DNA coding sequence of the pigmenttransporter from each snake you find these two DNA sequences (hashmarks have been added to indicate the reading frame):

pale tan snake: GCG/TTG/GAC/TGC/ACC (DNA template strand)CGC/AAC/CTG/ACG/TGG (complementary strand) dark brown snake:ACG/TTG/GAC/TGC/ACC (DNA template strand) TGC/AAC/CTG/ACG/TGG(complementary strand)

7. From these sequences you conclude:

a) that the amino acid sequence of the pigment transporters forthe two proteins are almost identical

b) that the amino acid sequence of the pigment transporters forthe two proteins are very dissimilar

c) that the amino acid sequence of the pigment transporters forthe two proteins are identical

8. Since the skin color is different in each snake, you concludefrom the sequence data above that:

a) the genetic code in the skin cells in each of these snakes isdifferent

b) the DNA sequence encoding the entire gene for pigmenttransporters in these two snakes is different

c) that one of the codons in the gene for the pigmenttransporter in these two snakes is different

9. You are analyzing eukaryotic cells that have been exposed tothe radioactive uracil. In most cells the radioactive uracil isinitially localized in the nucleus and then moves from the nucleusto the cytoplasm. However, you observe that in some cells theradioactive molecules stay in the nucleus and never arrive in thecytoplasm. This is most likely a defect in:

a) the transcription of the DNA

b) the processing of the mRNA

c) the translation of the RNA

d) the labeling of the RNA

e) the replication of the DNA

10. Which of the following is true of both eukaryotic andbacterial transcription? (select all that are true)
a) Transcription factors must bind the promoter before RNApolymerase initiates transcription

b) Messenger RNAs must be spliced before translation begins inorder to produce the appropriate gene product

c) During transcription only one DNA strand is used as atemplate to make the messenger RNA

d) Termination of transcription occurs when the RNA polymerasetranscribes a hairpin structure in the RNA followed by a string ofU

erinporpoise384

1. The following sequence is one strand of DNA from a region of the chromosome that contains the start of transcription (including +1) of a gene in E. Coli.

A. Is the segment shown the template or non template (coding) strand?

B. Predict where transcription will start and what will be the sequence of the RNA transcript.

5â CGGGCAACGTCATTATACGA 3â

2.. A mutation changes the start codon of the gene for lac depressor (laci) to a stop codon. How would this affect transcription of the lac operon? How would it affect the cells ability to utilize lactose?

END 319 Lecture Notes - Lecture 15: Tata Box, Sigma Factor, Intrinsic Termination

Document Summary

Get access

Related Documents

END 319 Study Guide - Final Guide: Sigma Factor, Repressor, Xist (Gene)

END 319 Lecture Notes - Lecture 18: Snrnp, D-Loop, Complementary Dna

Related Questions