MCB 3020C Lecture Notes - Lecture 1: Cholera, Ganglioside, Natural Killer Cell

50 views6 pages

jadereindeer57

19 May 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Introns are removed and exons are joined to create mrna. 3. the sugar-phosphate backbone is held together with phospho-ester bonds: b and c, all of the above. If dna is labeled with light nitrogen, n-14, and then the cells are allowed to replicated in heavy nitrogen, n-15, for two generations. The dna is isolated using a cscl solution and put into an ultracentrifuge. 1. the core enzyme of rna polymerase binds the promoter region on the dna template: ribonucleotides are added to the 5" end of the transcript. 1. the viral genome can contain dna or rna the viral genome can be single stranded or double stranded. 1: has a reverse transcriptase enzyme that converts ssrna into dna, double stranded dna is integrated into the host cell genome, a and b, b and c. 6: which of the following is not a mechanism for gene transfer among bacteria, restricted transduction, conjugation transformation. Inhibits transcription so that protein synthesis cannot occur.

Related Questions

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

skyhamster121

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

1. Characters that show a continuous range of variation, such as height and eye color, usually are controlled:

a.	by a single gene with two alleles that are codominant.

b.	by many genes with an additive effect.

c.	by epistatic interactions between two genes.

d.	mainly by the environment, with only a small genetic component.

2. In humans, red-green colorblindness is inherited as a sex-linked recessive trait. In order for a woman to be red-green colorblind, which of the following statements must be true.

a.	Her mother must be red-green colorblind.

b.	All of her brothers must be red-green colorblind.

c.	Her father must be red-green colorblind.

d.	All of the above statements must be true if a woman is red-green colorblind.

3. The x-ray crystallography data collected by Rosalind Franklin suggested to Watson and Crick that the:

a.	structure of DNA is a double helix.

b.	two strands of the DNA molecule are joined by hydrogen bonds between the bases.

c.	four bases within DNA pair in a specific way.

d.	two strands of the DNA molecule are joined by covalent bonds between the bases.

4. In the genetic code, _________ one amino acid.

a.	one nucleotide specifies

b.	two nucleotides specify

c.	three nucleotides specify

d.	four nucleotides specify

5. During Meiosis I, a homologous pair of chromosomes may not separate, resulting in daughter cells that have extra chromosomes or are missing chromosomes. This can lead to genetic disorders, including Down Syndrome. This phenomenon is called:

a.	independent assortment.

b.	nondisjunction.

c.	segregation.

d.	crossing over.

6. You are a human geneticist studying the incidence of retinitis pigmentosa in the residents of Tristan de Cunha, a group of small islands in the middle of the southern Atlantic Ocean. The allele for retinitis pigmentosa, which causes a form of blindness, is inherited as an autosomal recessive. You have determined that the frequency of this allele (r) in the population is 0.4 (40%). Using the principles of the Hardy-Weinberg rule, you would estimate the frequency of individuals who are heterozygous for this allele (Rr) in the population to be:

a.	0.16 (16%)

b.	0.24 (24%)

c.	0.36 (36%)

d.	0.48 (48%)

7. Natural selection acts at the level of the:

a.	phenotype.

gene.

c.	population.

d.	nucleotide.

8. You are working with pea plants, trying to recreate the experiments that Mendel performed. You are doing a dihybrid cross with a plant that is heterozygous for both seed shape and seed color, with the genotype RrYy. Which allelic combinations would you expect to find in the gametes produced by this plant?

a.	This plant would produce only RY and ry gametes.

b.	This plant would produce only RrYy gametes.

c.	This plant would produce RY, Ry, rY, and ry gametes.

d.	You cannot determine which gametes this plant can produce without knowing the genotypes of its parents.

9. Biochemist Erwin Chargaff found that in DNA there is a special relationship between the four bases that we now call Chargaff's rule. His observation was that, in an organism's genome the:

a.	percentage of A nucleotides = the percentage of T nucleotides, and the percentage of C nucleotides = the percentage of G nucleotides.

b.	four bases all occur in an equal frequency (25%) within each organism.

c.	percentage of A nucleotides = the percentage of G nucleotides, and the percentage of C nucleotides = the percentage of T nucleotides.

d.	genetic material is composed of proteins, not DNA.

10. During DNA replication:

a.	each strand of the double helix acts as a template for the synthesis of a new strand.

b.	the enzyme DNA polymerase adds nucleotides to the strand being synthesized.

c.	the bases A,C,G and T are required.

d.	All of the above are true of DNA replication.

11. During translation, amino acids are joined by peptide bonds to make polypeptides. The formation of these peptide bonds is catalyzed by:

12. If an allele (R) at a gene with two alleles shows complete dominance, individuals with the genotypes ______ will have the same phenotype.

a.	RR and rr.

RR and Rr

Rr and rr

d.	Each of the three possible genotypes will have a different phenotype.

mauvefox570

MCB 3020C Lecture Notes - Lecture 1: Cholera, Ganglioside, Natural Killer Cell

Document Summary

Get access

Related Documents

MCB 3020C Lecture Notes - Lecture 1: Dna Replication, Replisome, Microbiology

Biochemistry 2280A Study Guide - Final Guide: Thymidine, Deoxyribonucleotide, Nitrogenous Base

CRJ 270 Lecture Notes - Lecture 10: Ribosomal Rna, Alternative Splicing, Primary Transcript

Related Questions