ELN Lab 7 5-23 DNA Isolation and PCR.docx

13 Pages
86 Views
Unlock Document

Department
Microbiology and Cell Science
Course
MCB 3020L
Professor
ashgar
Semester
Fall

Description
Chloe Evetts (8990-4674) Cameron Jacobs (7908-1325) DNA Isolation and PCR Purpose The purpose of this experiment is to learn how PCR and gel electrophoresis works, so that we can in the future use it in paternity tests, research, and diagnostic evaluations. PCR will amplify DNA sequences so they can be analyzed more clearly. This technique is often used in forensics. We will use it in the microbiology laboratory to identify our unknown organism. Hypothesis By running our unknown through the PCR process, we should be able to identify it based on its individual DNA sequences and genome. Procedure 1. DNA isolation Note: Inoculate 1 NA or TSB plate with a pure colony of your unknown organism >24 h PRIOR to DNA isolation. Note: make sure you have a pure culture Note: Wear gloves at all times. Supplies and Reagents (DNA extraction) • 2 x 1.5 mL microcentrifuge tube per sample. • Inoculating loop • Sterile 1X Sterile PBS buffer. • Microcentrifuge • Heating block • Chemglass beads • Vortex Procedure 1. Label everything. 2. Take a micro-centrifuge tube with 1mL 1x Sterile PBS buffer. 3. Harvest one whole plate of cells (scrape off without getting agar pieces). Use ALL cells and colonies, scrape off the agar plate using a sterile inoculating loop and suspend them in the micro tube with 1mL 1X Sterile PBS buffer (without the glass beads). 4. Vortex at max speed for 5 sec. 5. Centrifuge at 10,000 x g for 1 min. Look for a cell pellet. The DNA is in the pellet inside the cells. 6. Discard supernatant (suck off with P1000, without touching the pellet) 7. Add 0.5 mL 1x sterile PBS buffer to the pellet 8. Resuspend the pellet by vortexing at max speed until the whole pellet is dissolved. 9. Place in hot water bath at 85°C for 5min. 10. Transfer the content to a new microcentrifuge tube containing 0.1 mL Chemglass beads. 11. Vortex for 5 min at highest speed. 12. Centrifuge for 1 min at 10,000 x g. Your DNA is now in the supernatant. Transfer supernatant to new tube. Discard the pellet. You may stop at this point - listen to the instructions of your TAs. Detailed DNA Purification Protocol 1. Take 150uL of the DNA extraction supernatant. 2. Add 400μl of PowerClean™ DNA Solution 5 to the supernatant (be careful that solution doesn’t exceed rim of Collection Tube) and vortex for 5 seconds. PowerClean ™ DNA Solution 5 is a high salt concentration solution. Since DNA binds tightly to silica at high salt concentrations, this solution will adjust the salt concentrations to allow binding of DNA, but not non-DNA organic and inorganic material that may still be present at low levels, to the Spin Filters. 3. Load approximately 550μl onto a Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Discard the flow through and load the remaining supernatant onto the Spin Filter and centrifuge at 10,000 x g for 1 minute at room temperature. Note: A total of two loads for each sample processed may be required. DNA is selectively bound to the silica membrane in the Spin Filter device in the high salt solution. Contaminants pass through the filter membrane, leaving only the DNA bound to the membrane. 4. Add 500μl of PowerClean™ DNA Solution 6 and centrifuge at 10,000 x g for 30 seconds at room temperature. This solution is an ethanol based wash solution used to further clean the DNA that is bound to the silica filter membrane in the Spin Filter. This wash solution removes residues of salt and other contaminants while allowing the DNA to stay bound to the silica membrane. 5. Discard the flow through from the Collection Tube. The flow through fraction is non-DNA organic and inorganic waste removed from the silica spin filter membrane by the ethanol wash solution. 6. Centrifuge at 10,000 x g for 1 minute at room temperature. This second spin removes residual ethanol wash solution. It is critical to remove all traces of wash solution because the ethanol in PowerClean™ DNA Solution 6 can interfere with many downstream applications such as PCR, restriction digests and gel electrophoresis. 7. Carefully place the Spin Filter in a new Collection Tube (provided). Avoid splashing any PowerClean™ DNA Solution 6 onto the Spin Filter. Note: It is important to avoid any traces of the ethanol based wash solution. 8. Add 50μl of PowerClean™ DNA Solution 7 to the center of the white filter membrane. Note: Placing this Solution (sterile elution buffer) in the center of the small white membrane will make sure the entire membrane is wetted. This will result in a more efficient release of the DNA from the silica Spin Filter membrane. As PowerClean™ DNA Solution 7 (sterile elution buffer) passes through the silica membrane, DNA is released because it only stays bound to the silica Spin Filter membrane in the presence of high concentration of salt. PowerClean™ DNA Solution 7 is 10mM Tris pH 8 and does not contain EDTA. Alternatively, sterile DNA-Free PCR Grade Water (MO BIO Laboratories Catalog No. 17000-10) may be used for elution from the silica Spin Filter membrane at this step. 9. Centrifuge the Spin Filter at 10,000 x g for 30 seconds at room temperature. 10. Discard the Spin Filter. The DNA in the Collection Tube is now ready. No further steps are required. We recommend storing DNA frozen (-20° to -80°C). PowerClean™ DNA Solution 7 does not contain EDTA. 2. Quantify DNA Concentration BioTech Epoch Take 3 plate Procedure 1. Open Gen5 Program (BioTech program). 2. Under “Create New Item” menu, click “Take3”. 3. Double click on “Nucleic Acid” on the left side of the screen. 4. Select Sample Type “dsDNA” from drop down menu. 5. Make sure the Well Type is set to Microspot. 6. Open the Take3 plate lid to access the microspots. 7. Pipette 2 μL of the PBS Blank or H 2 into the microspots. 8. Close the plate lid GENTLY. 9. Select the BLANK wells to be read. Click Read Blanks. The tray door will open and the carrier will eject. 10. Place plate into the microplate carrier. Align “A1” on the plate with position “A1” on the carrier. 11. Press OK. The Blanks will be read by the instrument. 12. The door will open, remove plate, open the plate lid, and wipe off the Blanks off the top and bottom slides with a Kim Wipe. 13. Pipette 2 μL of the Samples into any of the microwells. Make sure you remember the location of your sample. 14. Place plate into the microplate carrier. Align “A1” on the plate with the “A1” position on the carrier. 15. Select the SAMPLE wells to be read (should be the same wells as the ones chosen for the Blanks). Click Read Samples and then click OK. 16. When finished, Excel will launch and display the results (you may need to click End of Batch). 17. Record results. 18. Determine the A 260nd A 280readings for each sample. Record this data and calculate the amount needed for your specific PCR reaction 3. 16s RNA PCR (Polymerase Chain Reaction) Supplies and Reagents • Sterile PCR Water • GoTaq Hot Start Colorless Master Mix stored at -20°C • 8F Primer (AGAGTTTGATCCTTGGCTCAG) at a concentration of 10 μM • 1492R Primer (GCYTACCTTGTTACGACTT) at a concentration of 10 μM • 0.2 mL microcentrifuge tube. • Micropipette • Eppendorf Mastercycler pro. • Micropipette Procedure Note: Never label the 0.2mL microcentrifuge tubes on the cap. The heat of the PCR Thermo Cycler lid will erase your labeling. Label the side of the micro tube. And always prepare the reaction mix to a final volume of 25μL. 1. Label everything. 2. Transfer 5 μL of your DNA sample to a PCR microtubes that already contains the master mix 3. Put the PCR tube in the PCR machine – by row Ingredient Concentration Amount DNA <250 ng Up to 5 μL Water 5 μL – DNA volume Master mix 20 μL Note: Mix by pipetting up and down or by “flicking” the tube with your fingers and do a quick spin down using the microcentrifuge. Note: The Master Mix contains (20 μL) 12.5 μL of Taq Hot Start Mix (Promega – M5133)) 2.50 μL 8F Primer 2.50 μL 1492R Primer 2.50 μL Sterile PCR Water Procedure – you don’t need to do anything for this step! Place samples in the PCR machine, and run the cycle. Initial denaturation 94.0°C - 1min. Amplification step is performed for 25 cycles 94.0°C - 30 sec 45.0°C - 45 sec 72.0°C – 1 min Final Extension 72.0°C – 5 min Unlimited final hold 4.0°C - ∞ Purify your product using the QIAGEN PCR purification kit. – Concurrently while running the agarose gel. Note: Always run a + and – control in each run. 4a. Agarose gel and electrophoresis Reagents and Supplies • Agarose (Fisher BP160-100) • 1X TAE buffer • Balance • Spatula • Weighing boats • 50mL Cylinder • 1 x GelStar Nucleic G
More Less

Related notes for MCB 3020L

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit