BIOL 1141 Lecture Notes - Lecture 16: Meiosis, Metaphase, Centromere

1). Explain the significance of the fact that gametes contain half of the chromosome complement of somatic cells. Tell me something about variation, if you have a sibling (if you don't imagine you do) - how is your sibling's genetic make-up similar and/or different from yours? What about your mom and dad?

2). Explain the terms reductional division and equational division. What is reduced or kept equal? To which nuclear divisions do these terms refer?

3). What is the diploid number (2n = ?) of an organism if it has
a) 12 chromosomes at Anaphase of Mitosis?
b) 12 chromosomes at Anaphase I of Meiosis?
c) 12 chromosomes at Anaphase II of Meiosis?

4). Compare/contrast Metaphase I of Meiosis with Metaphase of Mitosis.

5). What are the two mechanisms of variation in Meiosis, and during which stage(s) does each occur?

6). Draw a diagram of a bivalent and label the following parts: centromere, sister chromatids, non-sister chromatids, homologous chromosomes, chiasma.

7). A diploid cell has 1 pair of acrocentric chromosomes (Chromosome 1) and 1 pair of submetacentric chromosomes (Chromosome 2).
· Gene X is on Chromosome 1. Gene Y is on the short arm of Chromosome 2 and Gene Z is on the long arm of Chromosome 2.
· The maternal chromosomes have the X, y, z alleles, whereas the paternal chromosomes have the x, Y, Z alleles.
Draw these chromosomes, labeling ALL alleles, as they might appear in Metaphase I of Meiosis.

Question 1 (2 points)

In which phase of cell division is marked by the dissolution of the nuclear membrane, the condensation of chromosomes, and the formation of the mitotic spindle?

Question 1 options:

Question 2 (2 points)

The physical separation of cells during cell division is called:

Question 2 options:

Question 3 (2 points)

Meiosis is necessary for sexual reproduction; the gametes formed during this process before fertilization are _______________.

Question 3 options:

Question 4 (2 points)

Mitosis is the process by which a ___________ cell separates the chromosomes in its nucleus into two identical sets of nuclei.

Question 4 options:

Question 5 (2 points)

Which of the following statements about crossing over is INCORRECT?

Question 5 options:

PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT.

3'- GGCCTTAAGCATGCATGCAT -5'

5'- CCGGAATTC(G)TACGTACGTA -3'

1. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?

a) not enough information is provided

b) top strand

2. Which of the following occurs during Metaphase I of meiotic cell division?

a) Tetrads composed of homologous chromosomes line up at the center of the cell

b) homologous chromosomes separate

c) sister chromatid pairs line up at the center of the cell

d) non-sister chromatids exchange regions of DNA

3. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?

a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids

b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid

c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid

4. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.

I. DNA pol I synthesizes DNA

II. DNA ligase seals the nicks in the daughter DNA

III. DNA pol I removes the RNA primers

IV. DNA pol III synthesizes DNA

a) IV-III-I-II

b)I-III-IV-II

c) III-I-II-IV

5. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?

a) 0%

v) 100%

c) 25%

6. For oxytocin signaling between two neurons, what is the correct order of events?

I. an oxytocin vessicle fuses with the plasma membrane

II. an oxytocin vessicle docks with plasma membrane

III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron

IV. oxytocin molecules diffuse into the synapse

a) I-III-II-IV

b) II-I-IV-III

c) I-II-III-IV

7. The independent assortment of chromosomes is due to events that occur during ______.

a) meiosis I only

b) meiosis II only

c) mitosis and meiosis II