BIOL 2311 Lecture Notes - Lecture 15: Tryptophan, Methionine, Start Codon

32 views2 pages

harlequingiraffe61

26 Jun 2018

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.





 !

"#$$

%#

&#

'

(Neurospora crassa

)*+'

,

- .$

Transcription 'template strand 

"

Translation " 



DNA RNA NUCLEOTIDES:

&'/0'

1231&23123142

&"/03)3341)21&2

&5""! 



Genetic code:

&5

genetic code

&! 3"13)3342



+12codon

&+'+"

Features:

&"678+12

96736sense codons 

find more resources at oneclass.com

Unlock document

This preview shows half of the first page of the document.
Unlock all 2 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Early ideas to explain how genes work came from studying human diseases. Recognized that alkaptonuria is inherited via a recessive allele. Proposed that patients with the disease lacked a particular enzyme. Deliberately set out to create mutations in chromosomes and. U sed x-rays to dama ge dna. Had to have minimal media supplemented to grow. Transcription is the mechanism by which information encoded in the dna template strand is copied into a complementary rna strand. Translation uses the information encoded in the rna copy to assemble amino acids into a polypeptide. The dna alphabet consists of four letters representing the four bases of dna nucleotides: adenine (a), thymine (t), guanine (g), and cytosine (c) The rna alphabet consists of a, u, g, and c the base uracil (u) acts in place of thymine (t) The sequence of rna nucleotides in mrna is translated into a polypeptide containing 20 different types of amino acids.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 2311 Lecture Notes - Lecture 15: Tryptophan, Methionine, Start Codon

Document Summary

Get access

Related Documents

Biology 1201A Lecture Notes - Lecture 4: Central Dogma Of Molecular Biology, Dna Replication, Methionine

Biology 1201A Chapter 13: Chapter-13-Gene-Structure-and-Expression

BIOA01H3 Chapter Notes - Chapter 13: Precursor Mrna, Neurospora Crassa, Start Codon

Related Questions