MBG 2040 Study Guide - Final Guide: Aleurone, Repressor, Endosperm

80 views2 pages

whiteelk758

20 Apr 2018

School

University of Guelph

Department

Molecular Biology and Genetics

Course

MBG 2040

Professor

Krassimir Joseph Yankulov

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Watson and crick discovered the basic features of the dna double helix and predicted replication by a semi- conservative mechanism. Crick provided the first strong evidence in support of a triplet code he also proposed the wobble hypothesis. The dna of the cells grown on medium containing 15n have a greater density than the dna of cells grown on medium contain 14n. Molecules with different densities can be separated by equilibrium density centrifugation. From there they could compare the ratios of 15n to 14n. John cairns determined auto-radiographically that replication begins from an origin (oric) in e. coli. Robert lehman used dna fragment containing radio-active 32p and nucleases to release nucleoside monophosphate li(cid:374)ked to either the 5(cid:859) or 3(cid:859) (cid:272)ar(cid:271)o(cid:374), esta(cid:271)lishi(cid:374)g stra(cid:374)d continuity with dna ligase. Blackburn and szostak discovered the yeast telomere structure (discovered plasmid containing tetrahymena telomere sequence acquired yeast telomere sequence upon growth in cell) Greider identified tert (telomerase reverse transcriptase) and tr (telomerase rna)

Related Questions

1) The semiconservative nature of DNA replication (as shown inFig. 3.9) was proposed by Watson and Crick in 1953, but it wasn'texperimentally verified until 1958. Meselson and Stahl grewbacteria on the âheavyâ nitrogen isotope N15, producing DNA thatwas denser than normal. The food source was then abruptly switchedto one containing only N14. Bacteria were harvested and the DNAisolated by density gradient centrifugation.

What is the density of the DNA of the first-generation daughterDNA molecules? Explain.

What is the density of the DNA isolated after two generations?Explain.

What results would Meselson and Stahl have obtained had DNAreplicated conservatively?

2) a. One form of the diseaseadrenoleukodystrophy (ALD) is caused by the substitution of serinefor asparagine in the ALD protein. List the possiblesingle-nucleotide alterations in the DNA of the ALD gene that couldcause this genetic disease. b. In another form ofALD, a CGA codon is converted to a UGA codon. Explain how thismutation affects the ALD protein.

chocolatemacaw430

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

Multiply questions here

Q2. What is the consequence of chromosome inversion on meiosis? (work on a zygote with one normal chromosome and one chromosome with an inversion)

Q3. Search the web or read the textbook. Find a disease that is caused by translocation. What kind of translocation causes the disease?

Q4. Briefly explain how downâs syndrome or other trisomy is generated (3 sentences should be enough for you to explain this clearly)

Q5. I mutated a culture of wild type E. coli cells and wanted to isolate mutants that are unable to synthesize uracil (a nitrogen base in RNA). How can I achieve my goal? (try to finish your answer in 2-3 sentences)

Q6. For the ura- mutant isolated in Q5, I want to convert it to URA+ by transformation. Please tell me how I can achive this transformation with 3 SIMPLE sentences

Q7. What is the difference and relationship between an Hfr cell and an F+ cell?

Q8. I want to set up a mating between an Hfr strain and an F- (ade- his- bio-) strain and detect bio+ recombinant. Please design the experiment for me. (What genotype for Hfr do you need to choose? How will you select your recombinant? etc).

Q9. I want to use phage T2 to transducer the wild type ADE2 gene from the wild type E. coli strain to an ade2- E. coli mutant. How can I do this experimentally? (please briefly describe the approach, not experimental details such as incubation for 10 min, etc).

Q10. We talked about recombination in both eukaryotes and prokaryotes. Are there any differences in these two recombination ? (what are they if there are?)

Q11. Whose (or what) experiment proves that DNA is the genetic material?

Q12. What knowledge did Watson and Crick use in constructing the DNA model?

Q13. How does the double helix model support the three major functions of genetic materials?

Q14. What is the major chemical force that holds DNA and histone together? Hydrogen bonds

Q15. If I label E. coli cells in an N15 medium overnight and chase cells in an N14 medium for 2 generations, what fraction of cells still carry the N15 label?

Q16. If a 1000 kilobase fragment of DNA has five evenly spaced replication origins and DNA polymerase moves at 1 kilobase per second, how many seconds will a cell take to produce two daughter molecules?

Q17. DNA polymerases catalyze the polymerization of nucleotides. Use the formula for enzyme catalyzed reaction (see the example) to describe DNA polymerases. Example: Enzyme Substrate A + substrate B -------------------ï product c + product D Q8. During DNA replication, what is the direction of the growing strand?

Q18. For DNA synthesis in cells, why are there a leading strand and a lagging strand?

Q19. The following is the DNA sequence of a template strand. If the primase begins to synthesize primers from the middle âgâ, what will the primer sequence be? (assuming the primer can be 8 nucleotides long) 5â GACTCTAgGACTCCT 3â

Q20. Both DNA polymerase I and DNA polymerase III synthesize DNA during DNA replication. Please state the different roles they played during DNA replication.

sangriawallaby972

MBG 2040 Study Guide - Final Guide: Aleurone, Repressor, Endosperm

Document Summary

Get access

Related Documents

MBG 2040 Lecture Notes - Lecture 19: Semiconservative Replication, Dna Polymerase Iii Holoenzyme, Lambda Phage

MBG 2040 Chapter Notes - Chapter 10: G1 Phase, Central Dogma Of Molecular Biology, Lambda Phage

MBG 2040 Final: Chapter 10- DNA replication

Related Questions