CAS BI 107 Chapter Notes - Chapter 21: Expressed Sequence Tag, Globin, Sanger Sequencing

40 views3 pages

marooncrab512

5 May 2015

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Scientists use bioinformatics to analyze genomes and their functions: there are specific techniques and programs that scientists use to evaluate describe the gene sequences, these programs allow everyone to compare a specific dna sequence with every sequence in. Thousands of such sequences, called expressed sequence tags, or ests, have been collected from cdna sequences and are cataloged in computer databases. Multicellular eukaryotes have much noncoding dna and many multigene families: in eukaryotes, a single gene determines many functions and can predict many new proteins functioning differently in body. In genome of human, every gene bears specific areas coding the specific functions: the genes for noncoding rna products such as rrna, trna, and mirna make up only a small portion of the genomes of most multicellular eukaryotes. The first type are transposons, which move within a genome by means of a dna intermediate.

Related Questions

The ___ was a massive scientific undertaking meant to identify and sequence all of the genes found In a human cell. This is just one example of ______, the branch of biology that studies whole_____ , which are the complete sets of DNA found within organisms. One of the interesting conclusions from this project was that only about 1.5% of human DNA encodes for_____ . Although it was groundbreaking for its time, it is now fairly routine to completely sequence the DNA of an organism using the ______ method. In this method, the DNA is chopped up with restriction enzymes, the fragments are sequenced, and then they are reassembled into one continuous sequence. Through such analyses, scientists are learning much about human DNA and its relation to other species.

Terms:

proteins

genomics

genomes

genetic engineering

whole-genome shotgun

Human Genome Project

lavendercamel236

I just need someone to interpret exactually what I'm suppose todo here. I understand how to compare the sequecnces, however Idon't know exactually how to put them in order. also I can't findout how to find the what chromosome the sequence came from. So farall I gather to do from this is to find which segments overlap, addthe length, tell how big the chromesomeContigs and ShotgunSequencing
In this chapter, we discussed how wholeâgenome shotgun sequencingmethods can be used to assemble chromosome maps. Recall that in thetechnique of shotgun cloning, chromosomal DNA is first digestedwith different restriction enzymes to create a series ofoverlapping DNA fragments called contiguous sequences, or"contigs." The contigs are then subjected to DNA sequencing, afterwhich bioinformaticsâbased programs are used to arrange the contigsin their correct order on the basis of short overlapping sequencesof nucleotides.

In this Exploring Genomics exercise, you will carry out asimulation of contig alignment to help you understand theunderlying logic of this approach to creating sequence maps of achromosome. For this purpose, you will return to the NationalCenter for Biotechnology Information BLAST site that was used inother Exploring Genomics exercises and apply a DNA alignmentprogram called bl2seq.

Exercise I: Arranging Contigs to Create a Chromosome Map
1. Access BLAST from the NCBI Web site athttp://www.ncbi.nlm.nih.gov/BLAST/. Locate and select the "Aligntwo sequences using BLAST (bl2seq)" category at the bottom of theBLAST home page. The bl2seq feature allows you to compare two DNAsequences at a time to check for sequence similarityalignments.

2. Below are eight contig sequences taken from an actual humanchromosome sequence deposited in GenBank. For this exercise we haveused short fragments; however, in reality contigs are usuallyseveral thousand base pairs long. To complete this exercise, copyand paste two sequences into the Align feature of BLAST and thenrun an alignment (by clicking on "Align"). (Hint: Access thesesequences from the Companion Web site so that you can copy andpaste the sequences easily.) Repeat these steps with othercombinations of two sequences to determine which sequences overlap,and then use your findings to create a sequence map that placesoverlapping contigs in their proper order. A few tips toconsider:

â¢Develop a strategy to be sure that you analyze alignments for allpairs of contigs.
â¢Only consider alignment overlaps that show 100 percent sequencesimilarity.
Sequence A
CTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAT
TACAAGCATGAGCCACCACTCCCAGGCTTTATTTTCTATTTTTTAATTACAGCCATCCTAGTGAATGTGAAGTAGTATCTCACTGAGGTTTTGATTTGCATTTTTCTATGACA
ATGAACAATGTTTCATGTGCTTGTTGGCTGTTTGTATATCCTTTTTGGAGAAATACCAATTCATGTCCTTTGCCCATTTTTAAAGTGGATTGCATGTCTTTTTGTTGTTTAGT
TGTAAAGATGTGGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCT
CCTGCCTCAGCCTTCCAAGTAGCTGGGTTTACAGATGC

Sequence B
CTTTATCTCAGGACAATGAACCCGCAAGGAGAGGAAGAGCCAGTAATTCTATAGAGACTCGGAGGCGCAGGGGGCACGCTTAGTTAGAGTGGTGGTGGTATTTTCAGTGTTTT
CTGGTTTTATGATAAACACAAGCATCAATGTCTCAAGACTTTCATCTTTATCTTTTTTTTTTTTTTTTTTTTTTTCTTGAGACAGGGTTTCCCTCTGTCACCCAGGCTGGAGT
GCATTGGTGGTGTGATCTTGGCTTTCTGTAACCTCGGGCTTCTGGGCTCAAGCCGTTCTACTACCTCAGCCTCCCAAATAGCTAGAACTACAAGCGTGTGCTGCCACACCTGG
CTAATTTGTTGTATTTTATTTATTCATTTATTTTTGTGAAGACAAGGTCTTGCCATGTTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCCACCCACCTTAGTCTCC
CAAAGTGCTGGGATTACAGGCGTGAGCCACCACACCCA

Sequence C
GGAATTTCACTCTTGTTGCCCAAGTTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAACGATTCTCCTGCTTCACTCTCCCCAGTAGCTGG
GATTACAGGCTGCACCACCACACCTGGCTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCC
CACCTCAGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCACTCCCAGGC

Sequence D
GCTTCATCTTTCTCTTCACCGTAAAACAGGAAAGTGTGTGGTGACCAGTATTTTAAGGGAAAGGCACTTACAGAGAATTAAGCATTTGACAAAATTTATTTACAGATATTTGT
CTGTGGACCACTTCCGCACCAGCTGTGCATGAGAGGGCTCATTGCTCTGAATTTGCCTCCTTGTCTGCACCCAGGAGACCGTTTCCCAGATCACGCAAACGCTGCCTTCTCCC
CACACCAGGGCCCTCAGCATGGGAATGACCTTCCAGCGCTGCACGTTTCCAATCCATGCTCTGTTTTTCAGTTCTGGCTCACAGAGGACTGCTGGTTGCAAGCAAACTTGTAT
CTGGGTCTTCA

Sequence E
CCTTAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGAT
ATACAATTTGTAAATATTTTCTCTCATTTTGAAGATTTTCTTTTCACTTTCTTGATAATGTCCTTTGTGTATTTTTTGATAATGTCCTTTGATACACAAAAGTTTTTAAGTTT
GATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCAT

Sequence F
TGTTTGTTTGTTTGTTTTGTTTCATTTTGTTTTTGAGACAGAGTCTTGTTCTGTCGCCCAGTGTAGAGTGCAGTGGCATAATCTCGGCTCACCGTAACCTCCGCCTCCCGGGT
TCAAGCAACTCTGCCTGCCTCAGCCTCCCAAGGAGCTGGGATTATAGACGCCCACCACCATGCCTGGTTAATTTTTGTAGTTTTTTTTAGTAGAGATGGGGTTTTGCCATTTT
GGCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCCTGGCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCTGCCACACTCGGCCACAACAAATTTTTGCACC
AGTTGCTCACA

Sequence G
TCCTTTGATACACAAAAGTTTTTAAGTTTGATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCATTCATTTTGTGTCCTATGTAGGAATCTATTGCCAAATTCAAGGT
GATAAAGATTTACCCCTATGTTTCCTTCTAAGAGTTTTATTGTTTTAGCCCTGATATTTAGCTAAACTTAATTGATTTATTAAGTTTAATTTTCCTATGTGGTATGAAGTCAT
TTATCTTCTTTAGTTCAGGATCCAAGTGAAAGGGGCATCTTCTATCTGGGACATGCCATTCTCATGACAGAGGAAAAAGACAAAAAACTGACACATACAATGACTTTAAAACT
TCACTCA

Sequence H
GGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCTCCTGCCTCAGC
CTTCCAAGTAGCTGGGTTTACAGATGCCCACCACCATGCCTGGCTGGTTTTTGTATTTTTAGTAGACACGGGGTTTTACCATGTTGGCCGGGCTGGTCTGGAACTCCTAACCT
TAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGATATA
CAATTTGTAAA

3. On the basis of your alignment results, answer the followingquestions, referring to the sequences by their letter codes (Athrough H):

a.What is the correct order of overlapping contigs?
b.What is the length, measured in number of nucleotides, of eachsequence overlap between contigs?
c.What is the total size of the chromosome segment that youassembled?
d.Did you find any contigs that do not overlap with any of theothers? Explain.
4. Run a nucleotideânucleotide BLAST search (BLASTn) on any of theoverlapping contigs to determine which chromosome these contigswere taken from, and report your answer.
segment is, and what chromosome it came from. here's theassignment. I just need someone to interpret how I should go aboutdoing this.

viridianox52

CAS BI 107 Chapter Notes - Chapter 21: Expressed Sequence Tag, Globin, Sanger Sequencing

Document Summary

Get access

Related Documents

CAS BI 107 Chapter Notes - Chapter 20: Sanger Sequencing, Insecticide, Rna Biology

CAS BI 107 Chapter Notes - Chapter 13: Protein Kinase, Peptide, Cell Fractionation

LIFE 102 Lecture Notes - Lecture 48: Sanger Sequencing, Craig Venter, Human Genome Project

Related Questions