BIO SCI 98 Chapter Notes - Chapter 1: Ribosomal Rna, Transfer Rna, Pentose

28 views4 pages

blushmammoth506

19 Jun 2018

School

UC-Irvine

Department

Biological Sciences

Course

BIO SCI 98

Professor

RAZORENOVA/INLAY/MORRISETTE

For unlimited access to Textbook Notes, a Class+ subscription is required.

Page 47-50, 62-64, 175-181, 184-187, 209

The Central Dogma:

Information Flows from DNA to RNA to

Protein

-Watson and Crick

-Two strands of DNA in spiral, double helix

-Each strand is long string of 4 nucleotides: A, G, C, T

-Complementary strands: A pairs with T, C pairs with G = complementary base

pairs

-Double helical structure → logically replicated by separating the two strands to create a

new complementary strand → genetic information transmitted

-RNA = intermediate to move information from nucleus (DNA) to cytoplasm (RNA)

-Central dogma: DNA → RNA → protein

-DNA acts as its own template: DNA → DNA

-Some enzymes: RNA → DNA

-Some viruses: RNA → RNA

-Three different RNAs involved in protein synthesis:

-rRNA: ribosomes are the site of protein synthesis = large structures composed of

protein + RNA (also most abundant RNA)

-mRNA: nucleotide composition more similar to chromosomal DNA than rRNA

that can function as information carrier → used as template to direct construction

of protein sequence

-RNA polymerase synthesizes RNA by reading and pairing RNA bases to

DNA strand to create single-stranded RNA: transcription

-tRNA: base pairs with codon in mRNA and links amino acids together based on

mRNA strand: translation

-All RNAs are transcribed from DNA genes → functional RNAs: tRNA, rRNA,

mRNA

Nucleic Acids Are Long Chains of Nucleotides

-Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) store and transmit genetic

info

-Both composed of nucleotides linked together in long chains

1) Nitrogenous base

2) 5-carbon sugar (pentose)

3) Phosphate group

find more resources at oneclass.com

Unlock document

This preview shows page 1 of the document.
Unlock all 4 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Two strands of dna in spiral, double helix. Each strand is long string of 4 nucleotides: a, g, c, t. Complementary strands: a pairs with t, c pairs with g = complementary base pairs. Double helical structure logically replicated by separating the two strands to create a new complementary strand genetic information transmitted. Rna = intermediate to move information from nucleus (dna) to cytoplasm (rna) Central dogma: dna rna protein. Dna acts as its own template: dna dna. Three different rnas involved in protein synthesis: rrna: ribosomes are the site of protein synthesis = large structures composed of protein + rna (also most abundant rna) Mrna: nucleotide composition more similar to chromosomal dna than rrna that can function as information carrier used as template to direct construction of protein sequence. Rna polymerase synthesizes rna by reading and pairing rna bases to.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

13. The arms of a human and the wing of a bat are _________________ structures, composed of the same bones that have been modified for different functions.

analogous

vestigial

c.	homologous

d.	convergent

14. Xeroderma pigmentosum is an autosomal recessive genetic disorder. People who are homozygous for the disease-causing allele have skin that is damaged by exposure to ultraviolet radiation; this can lead to skin cancer at an early age. The mutation that causes this disorder is in a gene that functions:

a.	to repair DNA by excising (removing) nucleotides damaged by UV light.

b.	in lysosomes, to break down lipids that otherwise accumulate in the nervous system.

c.	to produce the UV blocking pigment melanin in the skin cells

d.	in red blood cells to carry oxygen to the skin.

15. The Amish are a religious sect descended from a small group of colonists who came to the United States over 200 years ago. Their religious beliefs have kept them isolated from society. The Amish have a much higher than average incidence of both polydactyly (extra fingers and toes) and dwarfism in their communities. This is most likely explained by:

a.	inheritance of acquired characters.

b.	the founder effect.

c.	disruptive selection.

d.	natural selection.

16. In the structure of DNA that Watson and Crick proposed, the sides of the "ladder" of the DNA molecule are always the same distance apart, making the molecule a constant width. This occurs because when the bases hydrogen bond to form the rungs of the "ladder", a:

a.	purine always pairs with a pyrimidine.

b.	purine always pairs with a purine.

c.	pyrimidine always pairs with a pyrmidine.

d.	The structure of the double helix is not determined by how the bases pair.

17. The RNA transcript of DNA that travels to the cytoplasm, carrying the instructions to make a protein, is called:

rRNA.

tRNA.

mRNA.

d.	RNA polymerase.

18. When DNA is replicated, the error rate is approximately one error for every 10,000 nucleotides copied. However, that error rate is reduced to only 1 error for every 1 billion nucleotides. The DNA sequence is "corrected" by:

a.	repeating S phase to see if the error rate is lower the second time around.

b.	enzymes that proofread the DNA and repair errors.

c.	messenger RNA during the process of transcription.

d.	Any errors made during DNA replication cannot be corrected. If errors are detected after S phase, the cell is destroyed.

19. Mendel's principle of segregation says that:

a.	when gametes are formed, each gamete receives only one allele for a particular gene.

b.	some genes are dominant to others.

c.	a testcross must be used to determine the genotype of an organism with a dominant phenotype.

d.	all of the above

20. Tay-Sachs disease is lethal before reproductive age, but the allele persists in Louisiana French Canadians because:

a.	it is a dominant allele.

b.	new mutations causing this disease are common in that population.

c.	it is not expressed in the phenotype of heterozygous individuals.

d.	the disease is contagious and can be transmitted by nonheritable means.

21. Physical features that are similar in organisms which are not closely related to each other are most likely a result of ____________. A good example of this is the similarities seen between some marsupial and placental mammals.

a.	natural selection.

b.	adaptation to similar environments

c.	convergent evolution

d.	All of the above phrases can be used to correctly fill this blank.

22. In humans, which of the following sex chromosome compliments could be found in males?

23. The proteins that are associated with eukaryotic chromosomes:

a.	help to package the DNA within the nucleus.

b.	are involved in gene expression, through binding with the DNA.

c.	may be replicating or transcribing the DNA.

d.	All of these are true of proteins that are associated with eukaryotic chromosomes.

24. A sequence of DNA nucleotides that contains the information to produce a single protein is a(n):

codon.

gene.

c.	polypeptide.

d.	anticodon.

whitelizard672

BIO SCI 98 Chapter Notes - Chapter 1: Ribosomal Rna, Transfer Rna, Pentose

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Biology

Concepts of Biology

Essentials of Biology

Related Documents

BIO SCI 98 Lecture Notes - Lecture 1: Ribosomal Rna, Transfer Rna, Uracil

BIO SCI 99 Chapter Notes -Purine, Heterocyclic Compound, Furanose

BIO 303 Lecture Notes - Lecture 18: Small Nuclear Rna, Antisense Rna, Telomerase Rna Component

Related Questions