BIOL 260 Chapter Notes - Chapter 4: Sister Chromatids, Nuclear Membrane, Nuclear Pore

28 views3 pages

puceraven738

10 Mar 2019

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

4. 2: gene expression (transcription and translation: types of rna, 1. ) mrna is a mirror image copy of target dna strand that travels to the cytoplasm to be translated into ribosomes and possibly proteins. It is found in the cytosol, and on the outside of the rough er and nuclear envelope. It forms a pre-mrna that must be spliced to remove introns, which are not expressed, and to connect exons together, which will be expressed, in order to form a matured mrna: translation occurs in three steps, 1. ) Initiation is where the mrna strand travels to the cytoplasm where a start codon is attached to the strand: 2. ) Elongation is where a trna arrives and starts attaching the appropriate complementary amino acids to the mrna: 3. ) 4. 3 dna replication and the cell cycle: steps of dna replication, 1. ) Dna double helix unwinds from histones: 2. )

Related Questions

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

skyhamster121

QUESTION 1. Compared to eukaryotic genomes, only prokaryotic genomes:

A. contain DNA organized by histones.

B. contain usually one, circular chromosome.

C. contain plasmid DNA.

D. have chromosomes contained in a nucleus.

QUESTION 2. Azathioprine is a drug that may be prescribed to transplant recipients to reduce the chance of tissue rejection reactions. In its active state, it acts as a purine analogue, inhibiting DNA biosynthesis. This means that 6-mercaptopurine will be inserted in place of a purine containing nucleotides during DNA replication. Given this drug's mode of action, you would expect it to be incorporated into DNA in place of:

A. nucleotides containing guanine or cytosine.

B. nucleotides containing adenine or thymine.

C nucleotides containing adenine or guanine.

D. nucleotides containing guanine nucleotide or uracil.

QUESTION 3. RNA is distinguished from DNA because only RNA:

A. typically exists as a single-stranded molecule.

B. has a 3' to 5' directionality.

C. is composed of nucleotides that contain the sugar deoxyribose.

D. is composed of nucleotides that contain the nitrogen bases T, C, G, and A.

QUESTION 4. How are RNA nucleotides different from DNA nucleotides? To be marked correct, you'll need to select all true statements, as there may be more than one correct answer.

A. RNA nucleotides do not contain thymine.

B. RNA nucleotides use the sugar ribose, while DNA nucleotides do not.

C. RNA nucleotides lack phosphate.

D. RNA nucleotides incorporate pyrimidine nitrogen bases, while DNA nucleotides only incorporate purine nitrogen bases.

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 260 Chapter Notes - Chapter 4: Sister Chromatids, Nuclear Membrane, Nuclear Pore

Document Summary

Get access

Related Documents

BIOL 260 Chapter Notes - Chapter 4.1: Friedrich Miescher, Nitrogenous Base, Adenine

BIOL 260 Lecture Notes - Lecture 5: Glycogen Phosphorylase, Sister Chromatids, Structural Level

BIOL 260 Study Guide - Quiz Guide: Nitrogenous Base, Dna Replication, Helicase

Related Questions