BIOLOGY 1A03 Lecture Notes - Lecture 7: Nuclear Membrane, Harpoon, Nucleoid
BIOLOGY 1A03 Full Course Notes
Document Summary
Get access
Related Documents
Related Questions
Chapter 10
1.Outline the history of our knowledge on DNA up to Watson and Crick. What were the main contributions made by each researcherâs key experiment?
2.Explain the setup of the Hershey and Chase experiment, what would the results have been if protein was the genetic material?
3.Draw the structure of a DNA nucleotide, labeling each main component correctly. How does an RNA nucleotide differ?
4.If a section of double stranded DNA contains 19% Adenine, how much Thymine is present?
5.You are a researcher studying the genetic basis of heart attacks and have been working to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below). The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels.Based on this information which genes would you predict to have the highest rate of transcription?
| Gene | Methylation levels |
| 1 | ++ |
| 2 | +++++ |
| 3 | +++ |
| 4 | ++ |
| 5 | + |
What are the characteristics of the 3 main DNA forms?
Chapter 11
What are the different types of chromatin?
What are the structures and important roles for telomeres and centromeres?
What are the differences found between eukaryotic chromosomes and mitochondrial?
Chapter 12
Explain each of the different models of replication.
If you grow a culture of bacteria in media with radioactive nucleotides so that all DNA in the cells include radioactive nucleotides and then place the bacteria in new non radioactive media. After two rounds of replication what proportion of the DNA molecules will contain radioactivity?
Summarize the similarities and differences between rolling-circle replication, theta replication and linear eukaryotic replication.
What are the functions of the different DNA polymerases found in eukaryotic cells?
Draw a replication fork and include all key components and orientations. (Leading/lagging strands, DNA helicase, RNA primer and DNA gyrase)
What is the Holliday model of recombination and what are the necessary steps?
Chapter 13
What are the different types of RNA and what roles do they play?
Describe the properties and functions of each of the RNA polymerases and how they differ depending on the organism.
Describe in detail the process and mechanisms of transcription in both prokaryotes and eukaryotes.
Chapter 14
What are the primary purposes of each of the three post transcriptional modifications that occur in eukaryotic cells.
What is alternative splicing and what role does it play in the cell?
How is ribosomal RNA processed after transcription?
How do siRNA and miRNA work, describe/draw out the process in detail.
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
| Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
| Lactose | Glucose | Lac expression? |
| No | Yes | |
| Yes | Yes | |
| Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
