BISC 101 Lecture Notes - Lecture 4: Post-Translational Modification, Pyrimidine, Purine

106 views3 pages

blushsquirrel122

5 May 2018

School

Simon Fraser University

Department

Biological Sciences

Course

BISC 101

Professor

Tony Williams

For unlimited access to Class Notes, a Class+ subscription is required.

BISC 101-DNA TRANSCRIPTION/TRANSLATION---PROTEIN SYNTHESIS

Key points

• DNA to protein= DNA-coded gene is usually transcribed into mRNA and sent out of the nucleus to be

translated into proteins within the cytoplasm

• purine has TWO rings = C5H4N4 (guanine, adenine); pyrimidine has ONE ring= C4H4N2 (cytosine,

thymine--- with RNA, thymine is replaced by uracil)

• if one purine pairs with one purine then it is too long, if one pyrimidine pairs with one pyrimidine then it is

too short; these two ases wo’t e struturall suitale to for a doule heli---this is the reason why

one purine must pair with one pyrimidine

DNA = A-T, G-C

RNA = A-U, G-C

• A-T= two hydrogen bonds; G-C= three hydrogen bonds.

• Nucleotides are joined by phosphodiester likage 3’-5’---H-bonds are keys to how two strands are joined.

• The two strands are antiparallel--- oe strad rus fro 3’ to 5’, the other strad rus fro 5’ to 3’

• Steps in making proteins: 1. Transcription 2. mRNA slicing 3. Translation

4. Post-translational modification

find more resources at oneclass.com

Unlock document

This preview shows page 1 of the document.
Unlock all 3 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Rna = a-u, g-c: a-t= two hydrogen bonds; g-c= three hydrogen bonds, nucleotides are joined by phosphodiester li(cid:374)kage 3"-5"---h-bonds are keys to how two strands are joined. The two strands are antiparallel--- o(cid:374)e stra(cid:374)d ru(cid:374)s fro(cid:373) 3" to 5", the other stra(cid:374)d ru(cid:374)s fro(cid:373) 5" to 3". 5" ccatataaacccgcccgactgatcatgctagcaagctgagaaggcctaa 3": tata box is upstream from the starting point--- tata box + start point = promoter, rna polymerase reads the template strand fro(cid:373) 3" to 5" (cid:271)ut it sy(cid:374)thesizes (cid:373)rna fro(cid:373) 5" to 3"= Rna polymerase only adds (cid:374)u(cid:272)leotides fro(cid:373) the 3" e(cid:374)d. Transcription factors bind to dna when they see tata box. Rna polymerase follows and binds to dna also. More transcription factors bind to dna along with the first few transcription factors and. Rna polymerase forming a unit called transcription initiation complex. Transcription initiation complex will start to break bonds and untwist dna double helix to do base-pairing by adding rna nucleotides that are complementary to the template strand.

Related Questions

1. Unlike DNA, RNA contains

deoxyribose

a double strand

phosphates

uracil

Nucleic acid structure

2. In transcription, uracil will bond with:

thymine

cytosine

adenine

guanine

Transcription

3. The first team of scientist to document the structure of DNA was:

Franklin and Wilkins

Watson and Crick

Pauling and Chargoff

None of the above

DNA structure

4. Organelles that synthesize protein are:

lysosomes

ribosomes

endoplasmic reticulum

golgi bodies

5. Most of the time in a cell's life, it's DNA is in the form of:

Chromatin

Chromatids

Replicated chromosomes

Spindle fibers

6. Uracil is a nitrogen base that pairs with adenine. Using this information, one could conclude that uracil is a:

Purine

Pyrimidine

Neither a purine or pyrimidine

Not enough information

7. a nucleotide does not consist of a:

polymerase

5-carbon sugar

phosphate group

nitrogen base

8. The genetic code in DNA of an individual depends on the sequence (order) of:

nucleotides

purines only

phosphates

sugars

9. Before a cell divides, it must duplicate its DNA in a process known as:

translation

transformation

transcription

replication

10. The basic unit (building block) of a protein is a (an):

carbohydrate

amino acid

lipid

hydrogen bond

11. Unlike DNA, RNA contains:

deoxyribose

a double strand

phosphates

uracil

12. The structure of DNA was first documented in:

1945

1953

1956

1962

13. In DNA replication, the new molecules produced are:

of unequal length

both assembled in the same direction

built with purines as the backbone

assembled in opposite directions

DNA replication

14. The "backbone" of DNA is composed of:

ribose and phosphates

deoxyribose and phosphates

ribose and uracil

deoxyribose and thymine

DNA structure

15. RNA differs from DNA in which of the following ways?

RNA is single-stranded

RNA contains ribose

RNA does not contain thymine

All of the above

DNA structure

16. Which of the following is NOT required for the transcription process itself?

RNA polymerase

DNA

uracil-containing nucleotides

ribosomes

skyhamster121

1.Which of the following is not true about DNA? a) it is found both in the nucleus and the cytoplasm b)it is double stranded and the standards are connected by hydrogen bonds between the base pairs c) A purine base always pairs with a pyrimidine base to make up the DNA code d) it is the control center for both cell activity and heredity 2.Which of the following represents accurate base pairing in DNA ?a) Adenine to Adenine b)Adenine to Uracil c)Thymine to Cytosine d)Adenine to Thymine 3. Purines and Pyrimidines are found a) DNA only b)RNA only c) A and B d)In proteins 4.The bond that forms between carbohydrates is called a)peptide bond b) ester bond c) glycoside bond d)never ending bone 5. Which of the following does not dissolve readily in water? a)proteins b) amono acids c) steroids d) carbohydrates 6. The following arrangement of amino acids represents what level of structure ? ABACABDD a)Primary b)Secondary c)Tertiary d)Quaternary

cerisedog238

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

ceruleangnat663

BISC 101 Lecture Notes - Lecture 4: Post-Translational Modification, Pyrimidine, Purine

Document Summary

Get access

Related Documents

BISC 101 Lecture Notes - Lecture 5: Dna Polymerase Iii Holoenzyme, Friedrich Miescher, Francis Crick

BISC 101 Lecture Notes - Lecture 7: Hydrolysis, Intellectual Disability, Phenylalanine Hydroxylase

BISC 101 Lecture Notes - Lecture 2: Aminoacyl-Trna, Hydrolysis, Peptide

Related Questions