BIO206H5 Lecture Notes - Lecture 8: Precursor Mrna, Sigma Factor, Globular Protein

20 views2 pages

crimsonsnake651

1 Oct 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Rna is synthesized from a dna template (template strand) Base sequence of rna is complementary to dna template. Eukaryotic primary transcripts are almost always processed: hnrna mrna protein. Rna polymerase allows sequential synthesis; one nucleotide at a time; synthesis occurring 5" to. 3" of the rna molecule but the reading of the template is occurring 3" to 5" (antiparallel) Nucleotides bring own energy source by the high energy phosphates attached to them. Bacterial rna polymerase is a globular protein complex. Composed of: a core enzyme containing 5 subunits with the catalytic site. A variable regulatory factor: sigma [ ]rna polymerase holoenzyme = core + . Variation in sigma factor allows for different gene expression. If a certain sigma factor is not there, then the gene is turned off. Beta segment allows for the whole enzyme to be situated on the dna molecule during transcription; allows for catalysis. Initial incorporation of ribonucleotides and linkage by phosphodiester bond.

Related Questions

Fill in the blank. Elongation during translation does NOT involve ____________.

Question 16 options:

	the translation of codons according to the genetic code
	the formation of bonds catalyzed by the ribosome
	complementary base pairing between RNA molecules
	amino acids being linked together in a polypeptide
	reading the DNA template 3' to 5'

For a given gene, what establishes the reading frame for translation?

Question 17 options:

	the location of the enhancer relative to the gene
	the first three nucleotides at the 5' end of the mRNA
	the first three nucleotides at the 3' end of the mRNA
	the start codon in the mRNA
	the location of the promoter relative to the gene

Which of the following is the LEAST likely direct consequence of a substitution mutation?

Question 18 options:

	changing the length of a protein coded for by a gene
	changing one amino acid in a protein
	creating a stop codon
	eliminating a start codon
	changing the length of the DNA molecule containing a gene

Suppose that the pre-mRNA transcript from a eukaryotic gene is 30,000 nucleotides long, and the gene codes for a sequence of 300 amino acids. What is the best explanation for the relationship between these numbers?

Question 19 options:

	only the first 900 nucleotides of the pre-mRNA transcript are translated
	it takes 100 nucleotides to specify a single amino acid
	300 of the nucleotides in the transcript are important, and the rest are "junk"
	only the last 900 nucleotides of the pre-mRNA transcript are translated
	large portions of pre-mRNA transcripts are cut out during RNA processing

Suppose an individual is born into a population with a novel mutation. Is the new mutation an evolutionary change, and why?

Question 20 options:

	no, because it is not a big enough change to count
	yes, because new mutations are always adaptive
	yes, because the appearance of a new genetic variant is a genetic change in a population
	no, because not enough individuals have the mutation for it to matter
	no, because most mutations are not adaptive

In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Streptococcus pneumoniae demonstrated that

	DNA is a double helix.
	DNA may be taken up by bacterial cells and be active.
	DNA is present in bacteriophage T2.
	eukaryotic cells may be genetically transformed.
	DNA binds to the cell wall of the bacterium.

In order to show that DNA in cell extracts is responsible for genetic transformation in Streptococcus pneumoniae, important corroborating evidence should indicate that _______ also destroy transforming activity.

	temperatures high enough to kill cells
	enzymes that hydrolyze proteins
	enzymes that hydrolyze DNA
	enzymes that hydrolyze polysaccharides
	enzymes that hydrolyze RNA

Based on what you have learned about the experiments conducted by Griffith and Avery and colleagues with bacteria, which of the following would result in transformation of living R cells?

	Pure RNA from S cells
	Cell-membrane extracts from S cells
	A mixture of pure RNA and protein from S cells
	Cell-free extracts from S cells
	Pure protein from S cells

A-T base pairs in a DNA double helix

	form three hydrogen bonds with each other.
	are more heat-stable than G-C base pairs.
	are of a substantially different length than G-C base pairs.
	are not accessible to DNA binding proteins.
	are chemically distinct from G-C base pairs.

If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the bases are uracil?

	27
	50
	0
	73
	23

The uniform diameter of the DNA structure provides evidence for

	antiparallel DNA strands.
	a right-handed helix.
	a double-stranded helix.
	3â² end phosphorylation.
	purineâpyrimidine pairing.

If a sequence of one strand of DNA is 5â²-TGACTATC-3â², what is the complementary strand?

	5â²-ACTGATAG-3â²
	3â²-TGACTATC-5â²
	3â²-ACTGATAG-5â²
	3â²-ACTGATAG-3â²
	5â²-TGACTATC-3â²

What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication?

	3â² end phosphorylation
	Purineâpyrimidine pairing
	Antiparallel DNA strands
	Covalent bonds between sugars and phosphate groups
	Hydrogen bonding between paired bases

If the MeselsonâStahl density gradient experiment had resulted in two bands of DNA molecules after only one round of replication, one containing only ¹⁵N and the second only ¹⁴N, this result would have indicated that replication was

	unidirectional.
	dispersive.
	conservative.
	bidirectional.
	semiconservative.

10.

The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3â² hydroxyl group (âOH). Predict what will happen if the host cell DNA polymerase incorporates a molecule of acyclovir into an elongating strand of HSV DNA.

	The replication complex will no longer bind to origins of replication.
	The DNA polymerase will only incorporate acyclovir molecules.
	Acyclovir will bind single-strand binding proteins.
	DNA polymerase will not be able to link a successive nucleotide.
	Acyclovir will block the activity of the DNA helicase.

11.

Which of the following does not demonstrate the stability of the DNA double helix?

	Single-strand binding proteins are required to keep the strands apart.
	Paired bases form hydrogen bonds.
	High temperatures are required to denature it.
	DNA synthesis requires energy.
	DNA helicases require ATP.

12.

What effect would a primase inhibitor have on DNA replication?

	DNA polymerase would not be able to add bases to the DNA.
	Primase would be blocked from joining the DNA replication complex.
	Primase would not be able to provide primers for DNA polymerases.
	DNA polymerase would not be able to use DNA as a template.
	There would be no effect on DNA replication.

13.

To replicate their DNA in a timely manner, most eukaryotic chromosomes

	normally have uncoiled DNA.
	have multiple origins of replication.
	contain linear molecules of single-stranded DNA.
	have two replication forks that move in the same direction.
	are composed entirely of DNA.

14.

Which statement about DNA replication is false?

	Okazaki fragments are synthesized as parts of the leading strand.
	Error rates for DNA replication are reduced by proofreading of the DNA polymerase.
	The sliding clamp increases the rate of DNA synthesis.
	Replication forks represent areas of active DNA synthesis on the chromosomes.
	Ligases and polymerases function in the vicinity of replication forks.

15.

In many eukaryotes, there are repetitive sequences called telomeres at the ends of chromosomes. After successive rounds of DNA replication, the _______ strand becomes shorter. In some cells, an enzyme called _______ repairs the shortened strand.

	leading; telomerase
	lagging; telomerase
	lagging; DNA polymerase I
	leading; DNA polymerase I
	leading; replicase

16.

A researcher studies normal human fibroblast cells. They can be maintained in culture but die off after about 30 cell generations. Unexpectedly, a colony of cells continues to survive and divide past 30 generations. Which scenario is most likely true for these cells?

	DNA polymerase is constantly active.
	Primase is able to extend the telomeres.
	The mismatch repair system is extra efficient.
	The telomerase gene is being expressed.
	The cells do not need the ends of their chromosomes.

17.

If DNA polymerase III introduces an incorrect nucleotide, what is the first corrective action made by the DNA repair system?

	The replication complex excises the incorrect nucleotide.
	The excision repair proteins remove the incorrect nucleotide.
	The mismatch repair system scans for base-pairing mismatches.
	There is no correction, because nucleotide errors by DNA polymerases are not repaired.
	DNA ligase connects the correct nucleotide.

18.

Choose the correct order of the following four events in the excision repair of DNA:
(1) Base-paired DNA is made complementary to the template.
(2) Damaged bases are recognized.
(3) DNA ligase seals the new strand to existing DNA.
(4) Part of a single strand is excised.

	1, 2, 3, 4
	2, 1, 3, 4
	3, 4, 2, 1
	2, 4, 1, 3
	4, 2, 3, 1

19.

Six complete cycles of PCR should result in a _______-fold increase in the amount of DNA.

	64
	32
	12
	128
	6

20.

When double-stranded DNA is heated to temperatures above 90Â°C, it denatures. Denaturation is a process that

	breaks covalent bonds.
	hydrolyzes DNA.
	separates double-stranded DNA into two single strands.
	causes new hydrogen bonds to form.
	irreversibly destroys the double helical structure.

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIO206H5 Lecture Notes - Lecture 8: Precursor Mrna, Sigma Factor, Globular Protein

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Concepts of Biology

Biology

Essentials of Biology

Related Documents

BIO206H5 Lecture Notes - Lecture 6: Peptide, Precursor Mrna, The Sequence

BIO206H5 Lecture 6: BIO206_Lec6_TranscriptionProkaryotic_Sept24

BIO206H5 Lecture Notes - Lecture 7: Critical Role, Rna, Sigma Factor

Related Questions