BIO372H5 Lecture Notes - Lecture 1: Nucleic Acid Double Helix, Chromosome
Document Summary
Get access
Related textbook solutions
Related Documents
Related Questions
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
| Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
| Lactose | Glucose | Lac expression? |
| No | Yes | |
| Yes | Yes | |
| Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
13. The arms of a human and the wing of a bat are _________________ structures, composed of the same bones that have been modified for different functions.
| a. | analogous |
| b. | vestigial |
| c. | homologous |
| d. | convergent |
14. Xeroderma pigmentosum is an autosomal recessive genetic disorder. People who are homozygous for the disease-causing allele have skin that is damaged by exposure to ultraviolet radiation; this can lead to skin cancer at an early age. The mutation that causes this disorder is in a gene that functions:
| a. | to repair DNA by excising (removing) nucleotides damaged by UV light. |
| b. | in lysosomes, to break down lipids that otherwise accumulate in the nervous system. |
| c. | to produce the UV blocking pigment melanin in the skin cells |
| d. | in red blood cells to carry oxygen to the skin. |
15. The Amish are a religious sect descended from a small group of colonists who came to the United States over 200 years ago. Their religious beliefs have kept them isolated from society. The Amish have a much higher than average incidence of both polydactyly (extra fingers and toes) and dwarfism in their communities. This is most likely explained by:
| a. | inheritance of acquired characters. |
| b. | the founder effect. |
| c. | disruptive selection. |
| d. | natural selection. |
16. In the structure of DNA that Watson and Crick proposed, the sides of the "ladder" of the DNA molecule are always the same distance apart, making the molecule a constant width. This occurs because when the bases hydrogen bond to form the rungs of the "ladder", a:
| a. | purine always pairs with a pyrimidine. |
| b. | purine always pairs with a purine. |
| c. | pyrimidine always pairs with a pyrmidine. |
| d. | The structure of the double helix is not determined by how the bases pair. |
17. The RNA transcript of DNA that travels to the cytoplasm, carrying the instructions to make a protein, is called:
| a. | rRNA. |
| b. | tRNA. |
| c. | mRNA. |
| d. | RNA polymerase. |
18. When DNA is replicated, the error rate is approximately one error for every 10,000 nucleotides copied. However, that error rate is reduced to only 1 error for every 1 billion nucleotides. The DNA sequence is "corrected" by:
| a. | repeating S phase to see if the error rate is lower the second time around. |
| b. | enzymes that proofread the DNA and repair errors. |
| c. | messenger RNA during the process of transcription. |
| d. | Any errors made during DNA replication cannot be corrected. If errors are detected after S phase, the cell is destroyed. |
19. Mendel's principle of segregation says that:
| a. | when gametes are formed, each gamete receives only one allele for a particular gene. |
| b. | some genes are dominant to others. |
| c. | a testcross must be used to determine the genotype of an organism with a dominant phenotype. |
| d. | all of the above |
20. Tay-Sachs disease is lethal before reproductive age, but the allele persists in Louisiana French Canadians because:
| a. | it is a dominant allele. |
| b. | new mutations causing this disease are common in that population. |
| c. | it is not expressed in the phenotype of heterozygous individuals. |
| d. | the disease is contagious and can be transmitted by nonheritable means. |
21. Physical features that are similar in organisms which are not closely related to each other are most likely a result of ____________. A good example of this is the similarities seen between some marsupial and placental mammals.
| a. | natural selection. |
| b. | adaptation to similar environments |
| c. | convergent evolution |
| d. | All of the above phrases can be used to correctly fill this blank. |
22. In humans, which of the following sex chromosome compliments could be found in males?
| a. | XY |
| b. | XX |
| c. | Y |
23. The proteins that are associated with eukaryotic chromosomes:
| a. | help to package the DNA within the nucleus. |
| b. | are involved in gene expression, through binding with the DNA. |
| c. | may be replicating or transcribing the DNA. |
| d. | All of these are true of proteins that are associated with eukaryotic chromosomes. |
24. A sequence of DNA nucleotides that contains the information to produce a single protein is a(n):
| a. | codon. |
| b. | gene. |
| c. | polypeptide. |
| d. | anticodon. |
1. Characters that show a continuous range of variation, such as height and eye color, usually are controlled:
| a. | by a single gene with two alleles that are codominant. |
| b. | by many genes with an additive effect. |
| c. | by epistatic interactions between two genes. |
| d. | mainly by the environment, with only a small genetic component. |
2. In humans, red-green colorblindness is inherited as a sex-linked recessive trait. In order for a woman to be red-green colorblind, which of the following statements must be true.
| a. | Her mother must be red-green colorblind. |
| b. | All of her brothers must be red-green colorblind. |
| c. | Her father must be red-green colorblind. |
| d. | All of the above statements must be true if a woman is red-green colorblind. |
3. The x-ray crystallography data collected by Rosalind Franklin suggested to Watson and Crick that the:
| a. | structure of DNA is a double helix. |
| b. | two strands of the DNA molecule are joined by hydrogen bonds between the bases. |
| c. | four bases within DNA pair in a specific way. |
| d. | two strands of the DNA molecule are joined by covalent bonds between the bases. |
4. In the genetic code, _________ one amino acid.
| a. | one nucleotide specifies |
| b. | two nucleotides specify |
| c. | three nucleotides specify |
| d. | four nucleotides specify |
5. During Meiosis I, a homologous pair of chromosomes may not separate, resulting in daughter cells that have extra chromosomes or are missing chromosomes. This can lead to genetic disorders, including Down Syndrome. This phenomenon is called:
| a. | independent assortment. |
| b. | nondisjunction. |
| c. | segregation. |
| d. | crossing over. |
6. You are a human geneticist studying the incidence of retinitis pigmentosa in the residents of Tristan de Cunha, a group of small islands in the middle of the southern Atlantic Ocean. The allele for retinitis pigmentosa, which causes a form of blindness, is inherited as an autosomal recessive. You have determined that the frequency of this allele (r) in the population is 0.4 (40%). Using the principles of the Hardy-Weinberg rule, you would estimate the frequency of individuals who are heterozygous for this allele (Rr) in the population to be:
| a. | 0.16 (16%) |
| b. | 0.24 (24%) |
| c. | 0.36 (36%) |
| d. | 0.48 (48%) |
7. Natural selection acts at the level of the:
| a. | phenotype. |
| b. | gene. |
| c. | population. |
| d. | nucleotide. |
8. You are working with pea plants, trying to recreate the experiments that Mendel performed. You are doing a dihybrid cross with a plant that is heterozygous for both seed shape and seed color, with the genotype RrYy. Which allelic combinations would you expect to find in the gametes produced by this plant?
| a. | This plant would produce only RY and ry gametes. |
| b. | This plant would produce only RrYy gametes. |
| c. | This plant would produce RY, Ry, rY, and ry gametes. |
| d. | You cannot determine which gametes this plant can produce without knowing the genotypes of its parents. |
9. Biochemist Erwin Chargaff found that in DNA there is a special relationship between the four bases that we now call Chargaff's rule. His observation was that, in an organism's genome the:
| a. | percentage of A nucleotides = the percentage of T nucleotides, and the percentage of C nucleotides = the percentage of G nucleotides. |
| b. | four bases all occur in an equal frequency (25%) within each organism. |
| c. | percentage of A nucleotides = the percentage of G nucleotides, and the percentage of C nucleotides = the percentage of T nucleotides. |
| d. | genetic material is composed of proteins, not DNA. |
10. During DNA replication:
| a. | each strand of the double helix acts as a template for the synthesis of a new strand. |
| b. | the enzyme DNA polymerase adds nucleotides to the strand being synthesized. |
| c. | the bases A,C,G and T are required. |
| d. | All of the above are true of DNA replication. |
11. During translation, amino acids are joined by peptide bonds to make polypeptides. The formation of these peptide bonds is catalyzed by:
| a. | DNA. |
| b. | mRNA. |
| c. | tRNA. |
| d. | rRNA. |
12. If an allele (R) at a gene with two alleles shows complete dominance, individuals with the genotypes ______ will have the same phenotype.
| a. | RR and rr. |
| b. | RR and Rr |
| c. | Rr and rr |
| d. | Each of the three possible genotypes will have a different phenotype. |
