BIO 103 Lecture Notes - Lecture 2: Guanine, Phosphodiester Bond, Deoxyribose

57 views2 pages

peachgnu262

31 Aug 2017

School

Stony Brook University

Department

Biology

Course

BIO 103

Professor

Kristen Vadasz

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Info in dna encoded by nitrogenous bases on inside of dna molecule. Bonds that hold the repeating units together = phosphodiester bonds. Dna made of repeating units called nucleotides. Dna is read from 5" to 3". Letters in genetic code of dna are a, c, g, and t: a = adenine, c = cytosine, g = guanine, t = thymine. Suggested that model of dna = 3 chained w/ phosphates near fibre axis and bases on outside. 2 helical chains coiled around same axis. Each chain consists of phosphate diester groups. Discovered that ratio of a is equal to t in dna. Ratio of complementary bases are always very close to unity for deoxyribose nucleic acid. Took x-rays of dna: found that dna was helical struct. Without this info, watson and crick wouldn"t have been able to come up with the information that they did.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIO 103 Lecture Notes - Lecture 2: Guanine, Phosphodiester Bond, Deoxyribose

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Concepts of Biology

Biology

Essentials of Biology

Related Documents

ANTHROP 2E03 Lecture Notes - Lecture 11: Rosalind Franklin, Francis Crick, Deoxyadenosine

Biochemistry 2280A Study Guide - Final Guide: Thymidine, Deoxyribonucleotide, Nitrogenous Base

BIO 325 Lecture 4: Deoxyribose Nucleic Acid

Related Questions